• Black Tails Gijinka

    Black Tails Gijinka

    C'est le Tails dans Sonic.exe


  • Commentaires

    1
    Vendredi 8 Juillet 2016 à 15:05

    Il est classe ! ^^

    2
    Vendredi 8 Juillet 2016 à 15:05

    Merci^^

    3
    Vendredi 8 Juillet 2016 à 21:15

    Tu pourra faire la même en Knukcles? XD ( il est sympa mais je préfère le jaune XD.)

    4
    Vendredi 8 Juillet 2016 à 21:21

    Laisse moi juste chercher une image et je m'y met (perso, je le préfère comme ça.) Après Knukles, je ferait Tails Dolls

    5
    Vendredi 8 Juillet 2016 à 21:23

    XD

    Tails: non mais oh, tu me préfère avec une tête triste.... Alors,là, je refuse ....ù_ù

    6
    Vendredi 8 Juillet 2016 à 21:29

    Katrina: t'as pas à être victime de Sonic.exe^^

    7
    Vendredi 8 Juillet 2016 à 21:31

    Non mais oh, espèce de cannibale XD t'es cruelle,toi.. XD

    T'es pas gentille avec Tails , Knukcles et Amy XD

    8
    Vendredi 8 Juillet 2016 à 21:33

    On est des thug 8D

    9
    Vendredi 8 Juillet 2016 à 21:34

    GRRRRRRRRRRRRRR (XD, je fait Tails XD)

    Knukcles:........... FUCK U,Sonic.exe!!!

    Eggman:Ouais,fuck! ^-^

    Vous êtes sérieux??

    Knukcles: Bah oui...

    10
    Vendredi 8 Juillet 2016 à 21:35

    Sonic.exe: je devrait me laisser impression par une bande de bras-cassés?! ê_e

    11
    Vendredi 8 Juillet 2016 à 21:36

    Laisse tomber,Sonic.exe, ils ont perdus la tête...... ù_ù

    Knukcles: Toi aussi t'es un bras cassé,tails!!

    Ouais mais moi, j'asume!!!

    Eggman:......... Ouias, le pire de tout le groupe!

    EGGMAN,BOUCLE LA!!!!!

    Eggman: Nope!

    O_O'

    12
    Vendredi 8 Juillet 2016 à 21:39

    Sonic.exe: vive le respect ^~^

    13
    Vendredi 8 Juillet 2016 à 21:41

    Bon je crois que...

    Knuckles et eggman: Que quoi?

    ME SUICIDER!!!

    Amy: Ouais! Comme sa je pourrais restée avec mon Sonic pendant que tu vas crevé en enfer!!

    TOI, FERME TA FRAISE!

    Amy: Nope!

     

    14
    Vendredi 8 Juillet 2016 à 21:42

    Sonic.exe: quel bande de bras cassés -_-

    15
    Vendredi 8 Juillet 2016 à 21:44

    Knukcles: Tu te suicide, je te fout un de ces coup, que tu aura mal...

    Ben..non...... Sinon, on fait quoi?

    16
    Vendredi 8 Juillet 2016 à 21:47

    Sonic.exe: je pourrait me servir de vous pour m'entraîner au lancer couteau comme Daisy.exe me l'a conseillé ^~^

    17
    Vendredi 8 Juillet 2016 à 21:49

    Whut.....

    Yoshi:*s'incruste* S-S...... Impossible

    Euh..Si Yoshi

    Yoshi: *se planque car il a peur de Sonic.exe *

    ^_^' Je crois que je vais péter un mur....

    Knukcles: WHUT....?! Il est débile?

    eggman: Je crois...

    18
    Vendredi 8 Juillet 2016 à 21:52

    Sonic.exe*regarde Yoshi*

    19
    Vendredi 8 Juillet 2016 à 21:56

    Yoshi: *se planque derrière moi*

    Laisse moi, tu vois pas que j'essai de casser le mur.........

    Yoshi:*me regarde* Cool, je veux faire comme toi *se met à casser le mur avec moi ù_ù*

    Eggman: WTF ^_^'

    Knukcles: What happening?

    Eggman: ... Bon... ils ont tout les 3 péter un plomb, 1 de 8 ans et 1 de 23 ans qui veulent péter le mur et un de 16 ans qui dit: What happening.....

     

    20
    Vendredi 8 Juillet 2016 à 21:58

    Sonic.exe: tu trouve ça bizarre? Attend d'avoir vu un Yoshi penser qu'à son estomac se faire tuer en boucle par une princesse droguée au cannabis u_u

    21
    Vendredi 8 Juillet 2016 à 22:01

    Mario: OH HELP!  *regarde sonic.exe* Pourquoi tu veut pas redevenir Sonic, celui qu'on a tous connu, hein?

    Oui ,sa c'est vrai...^-^' *se met à côté de Mario*

    Yoshi,Knukcles et Eggman: OUAIS! Mario dit vrai!!! *nous rejoignent et entourent tous Sonic.exe et le regardent*

    22
    Vendredi 8 Juillet 2016 à 22:06

    Sonic.exe: désolé. J'ai trouvé un place bien meilleure au côté des creepypasta^^

    23
    Vendredi 8 Juillet 2016 à 22:07

    Tout le monde: OwO *tombent tous par terre*

    Yoshi: ET NON JE VAIS PAS MOURIR, ABRUTIS!!!

    24
    Vendredi 8 Juillet 2016 à 22:09

    Sonic.exe: désolé^^

    25
    Vendredi 8 Juillet 2016 à 22:11

    Mario: ET TON BUT EST DE NOUS TUER!!!!

    Eggman:* commence à trembler*

    *rigole* Alors,Eggman,tu tremble *se moque de lui*

    Eggman: TAIS TOI,MOI AU MOINS,J'ETAIS PAS LE 1 A ETRE MORT PAR CETTE IMBECILE DE SONIC!!!

    ROAH SA VA!!!!

    26
    Vendredi 8 Juillet 2016 à 22:19

    Sonic.exe: c'est pas mon seul but^^

    27
    Vendredi 8 Juillet 2016 à 22:21

    Mario,Knukcles,Yoshi,moi et Eggman: *commençent à paniqué*

    Mario: Mamamiaaaaaaa* appeuré*

    Tails: Now way....

    Yoshi: OH WE FUCK!

    Eggman: WTF WTF!!!!!

    Knukcles:GAME OVER,YEAH

    Yoshi,Mario et moi: * prennent un pistolet et tirent une balle à Knukcles*

    28
    Vendredi 8 Juillet 2016 à 22:24

    Sonic.exe:  VOUS VOUS CALMEZ!

    29
    Vendredi 8 Juillet 2016 à 22:26

     tout le monde: *courent*

    A quoi sa sert qu'on cours,en fête?

    Mario: LA QUESTION,NUL!

    Bah quoi......???

    Mario: O_O

    8D

    Mario: ù_ù

    ^-^'

    Mario: 8(

     

    30
    Vendredi 8 Juillet 2016 à 22:28

    Sonic.exe*soupir*

    31
    Vendredi 8 Juillet 2016 à 22:30

    ............ STOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOP!

    Knukcles,Yoshi te Eggman:*me regarde* O_O

    Arrêter!!!! Tous ce qu'on fait c'est de jouer les gosse de 4 ans 5ans?

    Knukcles:.........

    Mario:Ouais,c'est vrai....... sa

    32
    Vendredi 8 Juillet 2016 à 22:33

    Sonic.exe: en plus, on est pas dans une garderie

    33
    Vendredi 8 Juillet 2016 à 22:35

    Mario: Sorry.......

    Ouais,sinon.... on parler de quoi?

    Knukcles: Hum.... Je sais plus.....

    Eggman: Des buts de Sonic, déjà euh... nous tuer pour être comme lui, moche rempli de sang

    ...........  Ouf *soupir* décidément tu ne changeras jamais,Eggman....

    34
    Vendredi 8 Juillet 2016 à 22:38

    Sonic.exe: -_-

    Daisy.exe*apparaît* que se passe-t-il ici? J'ai entendu crier '-'

    35
    Vendredi 8 Juillet 2016 à 22:42

    T'exagère,Eggman.... Sonic fait ce qu'il veut.. enfin Sonic.exe.. désolé...

    Amy:*s'incruste* SONIC!!! TU EST TROP CLASSE COMME SA!

    O_O, dit Sonic, tu veux pas la tuée?

    Amy:OH mais t'es qu'un cannibale avec moi!

    Je sais XD mais je te déteste.....

    Amy: Moi aussi... ^-^

    Peach: *'sincruste aussi* Hello,Guys,comment allez-vous?

    Mario: Princesse! ^-^

     

    36
    Vendredi 8 Juillet 2016 à 22:46

    Daisy.exe*regarde Mario* sache que je suis pas celle que tu connaît. Je suis bien différente.

    Sonic.exe: Dame Daisy.exe..... arrêter avec votre pseudo air dark qui ne marche quand vous avez les yeux noirs -_-

    37
    Vendredi 8 Juillet 2016 à 22:50

    Mario: Je parler à Peach, mais merci de m'avoirprévenu

    Cream: (celle dans sonic.exe amis pas la normale mais celle comme Tails,Knukcles etc..) Salut.....

    Bah,pourquoi t'es comme sa?

    Cream:Je me suis suicider......

    Yoshi et Moi: QUOIIIIIIIIIIIIIIIIIIIIIIIIIIIII! *tombent*

    Mais pourquoi?

    Cream: Bah..euh....... J'ai rencontrer quelqu'un et il m'as direct tuer....

    Luigi.exe: Salut

    QUOI,Luigi.......

    Luigi.exe: OH YEAH!

    ................................... C'est le pays des exe......

    Yoshi: J'ai peur.......

    Eggman:Moi aussi...

    38
    Vendredi 8 Juillet 2016 à 22:52

    Attend... tu t'es suicider ou Luigi t'as tuer?

    Cream: Il m'as tuée..

    Alors pourquoi tu nous dis que tu t'es suicider????

    Cream:.....

    39
    Vendredi 8 Juillet 2016 à 22:52

    Daisy.exe*s'amuse à faire tenir une petite croix en bois en équilibre sur son doigt*

    Sonic.exe: il y en a pas qui viendrait du Creppy World?

    40
    Vendredi 8 Juillet 2016 à 22:54

    OMG! Y'a que des exe.....

    Mario:Super Mario

    TOI ,tait toi

    Mario:Tails!

    Quoi???

    Mario: Shut up, thank you

    ...... *réfléchit et ignore ce que Mario me dit*

    41
    Vendredi 8 Juillet 2016 à 22:56

    Daisy.exe*omnibulée par sa croix*

    42
    Vendredi 8 Juillet 2016 à 23:01

    *regarde Daisy.exe*

    Mario: vous avez pas envie de nous tuer,hein.... * stress*

    Luigi.exe: Salut,Mario

    Mario: No,laisse moi..

    Luigi.exe: *calin  à Mario*

    Mario: ............ Bon, j'ai plus qu'une chose à faire..

    Quoi?

    Mario: * mange un champignon mauve gravée d'une tête de morte* DEAD

    MARIO!

    Yoshi: il est sérieux...

    Mario: *réssucite*  Hello

    Yoshi,moi et Knukcles: *crient*

    Eggman: O ME GOD, OH ME GOD! *tourne sur lui même*

    (à demain pour la suite ^-^)

    43
    Vendredi 8 Juillet 2016 à 23:04

    Daisy.exe: arrêtez de vous suicider pour rien -_- il y a pas plus nul comme mort

    44
    Samedi 9 Juillet 2016 à 10:25

    (Hello)

    Ouais,Daisy.exe a raison..

    Yoshi: Bah Moi... c'est sûr je me suicide pas!!!!!!!

    Moi non plus XD

    Knukcles: Comme vous deux..

    Eggman: *fait le débile*

    Pis bon, après vous allez regretter de vous être suicider

    (j'ai fait un rêve trop louche,cette nuit...... y'avait les personnages de: Disney,Mario et ses amis et Sonic et ses amis, mais Sonic était un méchant, il était en Sonic.exe XD)

    45
    Samedi 9 Juillet 2016 à 10:33

    (XD) Daisy.exe: je dit surtout ça car Sonic.exe et moi-même ne nous sommes même pas suicidés

    46
    Samedi 9 Juillet 2016 à 10:35

    Comment vous avez fait XD

    Yoshi: Rassure moi, tu veux pas être come eux?

    Mais non,imbécile......

    Yoshi: Ouf...

    Je demande juste XD

    Mario: *dance, je sais pas pourquoi...*

    Eggman: .......... *réfléchit*

    47
    Samedi 9 Juillet 2016 à 10:38

    Sonic.exe: je suis tombé dans la folie alors que j'essayait de sortir d'un labyrinthe^^

    Daisy.exe: j'ai été victime d'un carambolage, hospitalisée et quelqu'un m'a empoisonné avec de l'arsenic^^

    48
    Samedi 9 Juillet 2016 à 10:41

    WTF........................... O_O *regarde Sonic.exe* Bah bravo ^_^''', il était compliqué,ce labyrinthe où t'as péter un plomb..?

    Yoshi:........  au Purée......; *regarde Daisy.exe*T'as pas eu de chance......

    Knukcles: *s'entraine*

    Mario: Hé, bah....... sa c'est un grand coup de poise que vous avez, la....

     

    49
    Samedi 9 Juillet 2016 à 10:46

    Sonic.exe: il était interminable -_-

    Daisy.exe: mais maintenant, je peux mourir en boucle, c'est pas mon problème^^ c'est juste que je laisse traîner mes anciens corps un peu partout '-'

    50
    Samedi 9 Juillet 2016 à 10:50

    Yoshi: *vomis* Beurk.....

    Ah d'accord......

    Knukcles: Sa devait être soulant à force,non?

    Mario: Bon sinon,on peut revenir sur vos buts,car moi j'attend de savoir vos objectif à part nous tuer....

    Eggman: Et nous rendre cannibale

    *Soupir* On a compris Eggman,si t'as peur de Daisy.exe et de Sonic.exe,les froussards dégage d'ici!

    Eggman: Cool, *s'en va.*

    51
    Samedi 9 Juillet 2016 à 10:57

    Daisy.exe: pour le moment, c'est trouver un briquet et du gaz pour que je brûle une ville^^

    Sonic.exe: et moi, préparer du pop-corn pour regarder le spectacle^^

    52
    Samedi 9 Juillet 2016 à 10:59

    Yoshi et Moi: Mais WHUT...... *se regardent*

    Bowser: *'sincruste*  salut

    Mario: Oh,Bowser...

    T'es devenu swag.... *rigole*

    Knukcles: tiens, tu veux qu'on s'entraine,le swag??

    Bowser: Ouais!! *s'entraine à battre Knukcles*

    Knukcles: *donne des coups de poing à Bowser,pour s'entrainer*

    ù_ù

    53
    Samedi 9 Juillet 2016 à 11:17

    Daisy.exe*regarde Bowser* sympa le briquet^^

    54
    Samedi 9 Juillet 2016 à 11:18

    Bowser: Roah.....?????

    Elle veut un briquet et du gaz...

    Bowser: j'ai pas de briquet, j'ai que du gaz............

    .... Ok

    (je fait un kisekae de Daisy.exe,tails et Sonic.exe, poour te faire 2 avatars de Sonic.exe et Daisy.exe XD)

    55
    Samedi 9 Juillet 2016 à 11:19

    Daisy.exe: mais tu crache du feu^^

    56
    Samedi 9 Juillet 2016 à 11:21

    Bowser: Pourquoi t'as besoin de gaz et d'un briquet,hein??? *donne le gaz à Daisy*

    57
    Samedi 9 Juillet 2016 à 11:24

    Daisy.exe: je veux brûler une ville^^

    58
    Samedi 9 Juillet 2016 à 11:25

    Bowser: Quel ville?Green hill zone? Royaume Champignon?

    Mario: Ce sont pas des villes!!!! ABRUTIS!

    59
    Samedi 9 Juillet 2016 à 11:27

    Daisy.exe: je sais pas encore^^ la première que je verrait^^

    60
    Samedi 9 Juillet 2016 à 11:29

    Bowser: Okay.... Je veux bien, amis parce que c'est toi, et que t'es une cannibale....

    Ouais XD

    61
    Samedi 9 Juillet 2016 à 11:35

    Daisy.exe: arrêtez de dire que je suis cannibale. J'ai pas mangé un seul être humain depuis 4 ans -_-

    62
    Samedi 9 Juillet 2016 à 11:38

    Bowser: d'accord.....

    Bon..... on fait quoi à part que Daisy.exe veux cramer une pauvre ville sans défense et que Sonic.exe veux admirer le spectacle...... -_-'

    63
    Samedi 9 Juillet 2016 à 11:40

    Sonic.exe: bah quoi? C'est beau les flammes

    64
    Samedi 9 Juillet 2016 à 11:41

    Pour toi, oui......

    Mario: Pour nous,non!

     

    65
    Samedi 9 Juillet 2016 à 11:44

    Sonic.exe: mais siiiiiiiiiiiiiiiii^^

    66
    Samedi 9 Juillet 2016 à 11:49

    ..... Bon

    Mario: (jouons à son jeu...)

    (Mais Mario sa se fait pas..; et en plus jamais je ne ferais sa à mon meilleur ami....... IDIOT!)

    Mario: Euh... ah oui  ^_^'''

    Pff

    67
    Samedi 9 Juillet 2016 à 11:55

    Daisy.exe*va chercher un ville*

    Sonic.exe*la suit*

    68
    Samedi 9 Juillet 2016 à 12:00

    *regarde Sonic.exe et rigole*

    Bowser: Bouhahaha *crache du feu qui crame sur l'une de mes deux queues*

    AIE!!!! SA BRULE!!!!!!!!! *cours partout*

    Mario: Attends,bouge plus, J.E.T va s'en charger!

    69
    Samedi 9 Juillet 2016 à 12:01

    E-beth*vous regarde depuis un endroit tranquille*

    70
    Samedi 9 Juillet 2016 à 12:06

    U

    COMMENT VEUX TU! BOWSER M'A CRAMER MA QUEUE!!!!!!!!

    Bowser:Pardon,Tails,je voulais pas te bruler!!!!!

    Tu refait plus sa!

    Bowser: Okay...

    Mario: *m'arrose et regarde ma queue* Elle a cramer!

    Non sans blague, elle est grise.......

    Bowser: Je suis désolé,Tails,pardonne moi..

    Mais c'est bon,je te pardonne, mais tu ne refait plus sa!!!!!

    71
    Samedi 9 Juillet 2016 à 12:09

    E-beth: pauvre boule de poil^^

    72
    Samedi 9 Juillet 2016 à 12:13

    Mario:Sa fait drôle!

    De quoi?

    Mario: T'as une queue Jaune et l'autre queue est grise XD

    MAIS PUREE,C'EST PAS DROLE!!!!!

    Bowser: Tiens,Mario comme sa t'aura une bonne leçon!! *crache du feu et crame Mario*

    Mario: MAMAMIOUHOUH

    Bah t'es pire que moi XD!

    Mario: JE SUIS TOUT GRIS!!!!!!! GRRRRRRRRR BOWSER!!!!!

    On joue pas avec le feu...

    Bowser:T'as raison!

    73
    Samedi 9 Juillet 2016 à 12:14

    E-beth: d'accord '-'

    74
    Samedi 9 Juillet 2016 à 12:17

    Nous 3 *se disputent Mario tout seul et Bowser et Tails à deux contre Mario*

    Mario:TU M'A CRAMER DE PARTOUT

    BAH EN MEME TEMPS TU TE MOQUE DE MOI! C'EST PAS DU TOUT DROLE D'AVOIR  UNE COULEUR DIFFERENTE SUR MES QUEUES!!!!!!

    Bowser: GRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR!

    75
    Samedi 9 Juillet 2016 à 12:25

    E-beth: bon.....*allume le porte-voix qu'elle a dans la gorge* SIIIIIIIIIIIIIIIIIILEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEENCE

    76
    Samedi 9 Juillet 2016 à 12:27

    Mario,Moi et Bowser: D'où venait ce bruit???

    Aucune idée...

    Bowser: Bizzar...

    Mario:Très louche...

    (http://camille-daisy.eklablog.fr/daisy-exe-car-tu-adore-ces-deux-personnages-a126351698, j'ai fini)

    77
    Samedi 9 Juillet 2016 à 12:33

    E-beth: de la cyborg à 8 mètres de vous -_-

    78
    Samedi 9 Juillet 2016 à 12:34

    Gné.....

    Mario:........ Cyborg?

    Bowser et Moi: Sa veut dire quoi?

    79
    Samedi 9 Juillet 2016 à 12:35

    E-beth*s'approche* que suis mi-humaine mi-robot

    80
    Samedi 9 Juillet 2016 à 12:37

    Oh d'accord!

    Knukcles: Comme Bunny!

    Knukcles.. On ne parle plus à Sally,Bunny t Antoine depuis X Temps.. abrutis...

    Knukcles: A Du coups Sonic aime Amy???

    ............................................. *regarde Knukcles *

    81
    Samedi 9 Juillet 2016 à 12:38

    E-beth*soupir*

    82
    Samedi 9 Juillet 2016 à 12:40

    ...... Sorry.;

    Bowser: Et qui êtes-vous?

    Mario: La dame blanche?

    *Frappe mario* imbécile!

    83
    Samedi 9 Juillet 2016 à 12:40

    E-beth: je suis E-beth, la soeur de Daisy.exe

    84
    Samedi 9 Juillet 2016 à 12:49

    Je savais pas que Daisy.exe avait une sœur...

    Mario et Bowser: Nous non plus.....

    85
    Samedi 9 Juillet 2016 à 12:50

    E-beth: j'ai vécu dans son ombre et contrairement à elle, c'est pas mon kiff de me faire remarqué

    86
    Samedi 9 Juillet 2016 à 12:55

    Ah....;

    Mario: Vous êtes.. timide?

    Bowser:Bouhahaha

    87
    Samedi 9 Juillet 2016 à 12:57

    E-beth: il y a une différence entre timide et discret.

    88
    Samedi 9 Juillet 2016 à 12:59

    Mario: Ah excusez moi.....

    XD il est tout rouge!

    Mario: *rougis*

    Bowser: XD PTDR

    89
    Samedi 9 Juillet 2016 à 13:02

    E-beth*regarde sa main de fer*

    90
    Samedi 9 Juillet 2016 à 13:04

    Bowser: Bah... Daisy.exe et Sonic.exe sont où?

    Partis crâmer une ville XD

    Mario:Laquel?

    Je sais pas...

    Knukcles: Comment?

    MAIS ARETER DE ME EGARDER ET DE ME POSER TANT DE QUESTIONS.......;!!!

    91
    Samedi 9 Juillet 2016 à 13:31

    E-beth: ils sont à la première ville qu'ils ont trouvé

    92
    Samedi 9 Juillet 2016 à 13:31

    Mario:Laquel?

    93
    Samedi 9 Juillet 2016 à 13:42

    E-beth*regarde un nuage de fumée* celle à quatre kilomètres '-'

    94
    Samedi 9 Juillet 2016 à 13:44

    Mario,yoshi,Moi,Knukcles te Bowser:*partent retrouver Sonic.exe et daisy.exe*

    95
    Samedi 9 Juillet 2016 à 13:48

    E-beth: pauvres mortels....*va rejoindre Daisy.exe*

    96
    Samedi 9 Juillet 2016 à 13:50

    Bowser:J'ai mal aux jambes..;

    Mario et Yoshi: Ouais nous aussi..

    Moi et Knukcles: Nous nan!

    Bowser: Normal, Toi Tails,t'as tes deux queues et Knukcles vole sans rien!

    Knukcles: je vole pas! je flotte sur l'air XD!

    98
    Samedi 9 Juillet 2016 à 14:07

    Bowser: Tails  tu veux pas me prendre?

    Euh...... T'es trop lourd,Bowser.....

    Mario: On y est!

    Yoshi: Salut les exe..

    Knukcles: elle a bien crâmer cette ville..

    99
    Samedi 9 Juillet 2016 à 14:09

    Sonic.exe*allongé sur un transat, regarde le spectacle*

    Daisy.exe*encore dans la ville*

    100
    Samedi 9 Juillet 2016 à 14:10

     *arrive et cache les yeux de Sonic.exe*

    Knukcles: *regarde la petite scène et rigole*

    Bowser:WTF;....

    Mario: IT MARIO TIMES ^_^

    101
    Samedi 9 Juillet 2016 à 14:12

    Sonic.exe: dégage -_-

    Daisy.exe*sort des flammes* c'est bon^^ j'ai enflammé le dernier bâtiment

    102
    Samedi 9 Juillet 2016 à 14:15

    Knukcles: MDR

    C'est pas un spectacle..... -.-' Okay... *s'éloigne de Sonic.exe, très loin*

    Mario: Nope,c'est une destruction.....

    Bowser: J'en ai marre d'être ici...

    Knukcles: Les gens, on se barre?

    Yoshi: ouais!

    Tou le monde: *S'en vont*

    103
    Samedi 9 Juillet 2016 à 14:16

    Sonic.exe: et une bande de bras cassés en moins -_-

    104
    Samedi 9 Juillet 2016 à 14:23

    Mario: *s'arrête et commence à péter un plomb*

    Mario! Laisse tomber!

    Knukcles: On peut rien faire....

    Yoshi,Knukcles,Moi et Bowser: *abandonnent et s'en vont*

    Mario:NON!

    Nous 4: Quoi non!

    Yoshi,Knukcles et Bowser: *s'en vont dans un endroit à l'écart de Mario...*

    Mario, tu ferais mieux de laisser tomber......

    Mario: Quoi! Mais vous allez pas vous laisser faire par cette abrutis!!!!!! Il essai de nous faire^peur!!! Vous pouvez pas abandonner comme sa...

    Hé bah nous, on en a marre! Maintenant fiche nous la paix! Si tu tiens vraiment à retser ici, RESTE, mais moi et les autres, on se barrent d'ici!!!! *s'en va*

    Mario: TAILS! ATTEND! Oh.... Regarde ce que tu as fait idiot!!!! *s'adresse à Sonic.exe*

    105
    Samedi 9 Juillet 2016 à 14:37

    Sonic.exe*regarde Mario*

    106
    Samedi 9 Juillet 2016 à 14:41

    (J'avais trouvée une image qui pourrais te plaire  mais je sais plus ou elle est sur internet.. sinon c'était une image où t'as Tails (Miles power) qui avait un couteau planté dans so ventre et genr y'avait plein de Tails Dolls qui le mordais Aux jambes aux bras et à ses deux queues je crois XD)

    Mario: *fait une tête salace en fixant Sonic;exe)

    *du côté de Bowser etc..*

    Knukcles: ...... Pourquoi le temps est tout moche?

    Bowser:Je....

    Luigi.exe: POUR VOUS TUER,BANDE DE BRAS CASSER!!!

    Bowser:....... *appeurer* AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH

    Yoshi: NOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOON!

    Knukcles: *tremble de partout* A L'AIDE!

    Bowser,Yoshi,Knuckles: A L'AIDEEEEE, MARIO!

    107
    Samedi 9 Juillet 2016 à 14:43

    Sonic.exe: tu essaie de me faire peur?

    108
    Samedi 9 Juillet 2016 à 14:47

    Mario: ^Non, mais toi AUISSI T'ES UN VBRAS CASSER!!!!

    *de mon côté*

    Luigi.exe: *essai de me tuer*

    TU CHERCHE VRAIMENT LES ENNUIS!!! LUIGI!

    Luigi.exe: PFFF!

    *sort un nuchaku*

    Luigi.exe: WTF, TU L'AS EU OU,CE STUPIDE TRUC?

    QUELQUE PART!!!!!!!!!!!

    *du côté de Mario*

    Mario: C'était quoi ce bruit?

    BOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOUM!

    109
    Samedi 9 Juillet 2016 à 14:53

    Daisy.exe*va voir ce qu'il se passe*

    110
    Samedi 9 Juillet 2016 à 14:58

    Mario: Super une baston...

    Luigi.exe: T'ES MORTEL,TAILS!

    ET ALORS!!!!!!!  JE VOIS PAS QUEL EST LE PROBLEME!!!!!!!!

    Luigi.exe:JE PEUX TE BATTRE A TOUT LES COUPS!

    JE PEUX SAVOIR CE QUE JE T'AI FAIT,HEIN?

    Luigi.exe: T'ES ENERVANT A COLLER SONIC.EXE!

    DEJA D'UNE JE NE LE COLLE PAS! *esquive les attaques de Luigi.exe*

    Luigi.exe: SI!

    NON!

    Luigi;exe: SIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII!

    111
    Samedi 9 Juillet 2016 à 14:59

    Daisy.exe: tout le monde se calme!

    112
    Samedi 9 Juillet 2016 à 15:01

    Luigi.exe: *ignore et continue de m'attaquer*

    *se barre*

    Luigi.exe: ATTEND! JE T'AI PAS ENCORE TUER, TAILS!

    LAISSE MOI! *prend Knukcles et retournent à Green hill zone*

    Bowser: * prend Yoshi et rentreent au royaume champignon*

    113
    Samedi 9 Juillet 2016 à 15:03

    Daisy.exe*regarde Luigi.exe*

    114
    Samedi 9 Juillet 2016 à 15:32

    Luigi.exe: Quoi?

    *de retours chez nous*

    Knukcles: Tails!Tu aurais pu mourir!!!!

    Désoler! Mais c'est Luigi qui m'as cherché!!!!!

    Knukcles: ^_^'  Mais écoute, on devrait en parler de Sonic qui a changer avec Yoshi et bowser! ALLER, VIENS! *s'en va au royaume champignon*

    D'accord!

    *au royaume champignon*

    Yoshi: AH! Vous voilà!

    Bowser: TAILS! T'ALLER RISQUER TA VIE POUR RIEN! IMBECILE! *me secoue*

    Roah,sa va.....

    Yoshi: MAIS C'EST VRAI! T'aurais pu être transformé en tails doll!!!

    Et alors?????

    Yoshi: SA NOUS AURAIT PAS PLUS!!!!!

    Knukcles: TES VRAIMENT NUL!!!!!!!!!!

    GRRRRRRRRRRRRRRRRRRRRRRRR AH SA SUFFIT, J'EN AI MARRE DE VOUS! *claque la porte et s'en va*

    Yoshi:.......

    (désolée mon père veut jouer à son ordi on se retrouve toute à l'heure ;))

    115
    Samedi 9 Juillet 2016 à 15:34

    (à plus^^) Daisy.exe: et dire que je pensait que tu étais le plus pacifiste d'entre nous....

    116
    Samedi 9 Juillet 2016 à 15:46

    (Bah en fête je peut y aller par ma 3ds mais c'est un peu délicat)

    Luigi.exe: Bah quoi,je voulais rendre service à Sonic.exe.......

    117
    Samedi 9 Juillet 2016 à 15:50

    Sonic.exe: j'ai jamais dit que j'avait besoin de service

    118
    Samedi 9 Juillet 2016 à 15:57

    Luigi.exe:......


    *De notre cotés*


    Yoshi:Il est fâcher après nous?


    Bowser:Oui... Juste parce que on dit à monsieur qu'il aurait pu mourir par sa faute!!!


    PFFF,y'a personne qui comprend dans quel état le monde est!!! TU PARLE DE VRAI AMIS!! QUI NE COMPRENNENT RIEN ET QUI FONT QUOI? LES ABRUTIS!!!*se parle tout seul.

    119
    Samedi 9 Juillet 2016 à 15:57

    Daisy.exe: bon.... ne restons pas sur ce différent

    120
    Samedi 9 Juillet 2016 à 16:17

    Luigi.exe:LA PROCHAINE FOIS QUE JE LE VOIT! JE LE TUE DIRECT!!!!!

    Mario:*me voit* Pourquoi t'es parti? je vous avez dit d'aller au château!

    Pardon,toi nous avoir dit sa,je crois pas!

    Mario: Oui bon sa va!!

    Bah non sa va pas!

    Mario:viens,on va se détendre à cette rivière.

    Okay......... -.- Mais pas longtemps!

    Mario:Pourquoi?

    Parce que j'ai du travail par derrière!

    Mario:Okay ^_* 

    121
    Samedi 9 Juillet 2016 à 16:17

    Luigi.exe:LA PROCHAINE FOIS QUE JE LE VOIT! JE LE TUE DIRECT!!!!!

    Mario:*me voit* Pourquoi t'es parti? je vous avez dit d'aller au château!

    Pardon,toi nous avoir dit sa,je crois pas!

    Mario: Oui bon sa va!!

    Bah non sa va pas!

    Mario:viens,on va se détendre à cette rivière.

    Okay......... -.- Mais pas longtemps!

    Mario:Pourquoi?

    Parce que j'ai du travail par derrière!

    Mario:Okay ^_* 

    122
    Samedi 9 Juillet 2016 à 16:18
    Mario: Ouf quel journée!!
    123
    Samedi 9 Juillet 2016 à 16:23

    Daisy.exe: nan -_-

    124
    Samedi 9 Juillet 2016 à 16:29
    Luigi.exe: SI! ^^Comme sa ils va pas nous soûler!
    Je pars!
    Mario:Quoi!déjà?
    Oui!désolé,Mario mais,je suis pas de bonne humeur! sur ce... bye!*s'en va*
    125
    Samedi 9 Juillet 2016 à 16:39

    Daisy.exe: il a encore rien fait e_e

    126
    Samedi 9 Juillet 2016 à 16:47

    *rentre dans son atelier,déprimé* j'en ai marre de cette stupide journée!!!!

    Luigi.exe: Et alors??

    127
    Samedi 9 Juillet 2016 à 16:51

    Daisy.exe: ça nous donne aucune raison de le tuer

    E-beth*toussote* comme les habitants de la ville que tu as brûlé

    Daisy.exe: ferme-là

    128
    Samedi 9 Juillet 2016 à 16:59

    Alors je peut le tuer ^^ !*s'en va et me recherche*

    *répare un objet* je vais voir ce qui y'a à la Télé..... *va dans son salon et regarde les infos*

    129
    Samedi 9 Juillet 2016 à 17:00

    Daisy.exe: LUIGI.EXE! REVIENT ICI TOUT DE SUITE*le suit*

    130
    Samedi 9 Juillet 2016 à 17:05

    Yoshi:Tails...*toque*

    Quoi?'-'

    Yoshi: je suis désolé pour toutes à l'heures!

    Mouais... je vous pardonne!

    Yoshi:je peux regarder les infos avec toi?.... Et mais!

    QUOI ENCORE!

    Yoshi:t'as cassé l'anciens cadre que sonic t'avait offert?

    Oui,ET??!

    Luigi.exe:*entend du bruit chez moi et nous voient* A te voilà,Tails!!

    131
    Samedi 9 Juillet 2016 à 17:12

    Daisy.exe*avec Luigi.exe*

    132
    Samedi 9 Juillet 2016 à 17:19

    Yoshi: Bah bien joué!

    Et??? Pis à quoi sa sert de garder ce cadre alors qu'il veut rester un exe,hein?

    Yoshi: pff,Sonic est devenue nul.....

    Ah,mais tu sais,tout le monde changent un jour ou l'autre........

    Yoshi:SA SE FAIT PAS!

    De???

    Yoshi: Sonic est méchant avec toi...

    Laisse-le :(

    Yoshi: Il te répond dégage!!! Je te plaint,tu devrais plus être son meilleur ami!!!

    133
    Samedi 9 Juillet 2016 à 17:23

    Daisy.exe*vous regarde*

    134
    Samedi 9 Juillet 2016 à 17:37

    C'est pas tes oignons!

    Yoshi:.............

    Luigi.exe: bon,comment attiré ces deux bras cassés?

    135
    Samedi 9 Juillet 2016 à 17:38

    Daisy.exe: tu ne le fait pas -_-

    136
    Samedi 9 Juillet 2016 à 17:44

    Luigi.exe:... Si! ET JE SAIS COMMENT! EN PLUS ILS SE MOQUENT DE SONIC!!!!TOI,TU ATTIRE TAILS ET MOI JE LE TUE PAR DERRIÈRE SANS QU'IL SENS REND CONTE!!:D

    137
    Samedi 9 Juillet 2016 à 17:49

    Daisy.exe: nan -_-

    138
    Samedi 9 Juillet 2016 à 18:06

    Luigi:QUE TU LE VEUILLE OU NON JE TURAIS TAILS!!

    *entend Luigi.exe et ouvre sa fenêtre et le voit* Tiens,tiens!Luigi.exe,que fait tu ici?

    Yoshi: Pfffff,pk tu viens nous embêter! on vous à rien fait,donc laissez nous!!!

    139
    Samedi 9 Juillet 2016 à 18:13

    Daisy.exe: mais c'est que je m'efforce à lui dire depuis tout à l'heure! o_o

    140
    Samedi 9 Juillet 2016 à 18:21

    Heureusement que Sonic n'est pas avec vous ^_^

    Yoshi: Pourquoi?

    Parce que je serais déjà parti depuis longtemps............ -_-!

    Luigi.exe:*me prend*

    ET,TU VAS ME LÂCHER!!!*tombe de la fenêtre*

    Luigi.exe:NON!

    *frappe fort Luigi et claque la fenêtre*

    IL EST CORIASSE!!!

     

    Yoshi:......Euh... Tails!

    Quoi?!

    Yoshi: regarde ton ventre

    Bah... j'ai rien???

    141
    Samedi 9 Juillet 2016 à 18:22

    Daisy.exe: Luigi Luigi Luigi...... tu es désespérant -_-

    142
    Samedi 9 Juillet 2016 à 18:32

    Yoshi: Mais qu'il est débile,ce renard! TA UN COUTEAU PLANTÉ DANS TON VENTRE!!!

    A Bon??? *regarde son ventre*......

    Yoshi: *commence à s'éloigner de moi*

    Euh.... Yoshi! je suis pas mort XD,Luigi m'a juste planté un couteau..

    Yoshi: Non-Non,t'approche pas de moi,t'es mort!!

    Mais non,imbécile -.- *retire le couteau,plein sang coule*

    Yoshi:*pleure*

    Calme toi! JE RÉPÈTE,JE-SUIS-PAS-MORT!!!! -_-'

    143
    Samedi 9 Juillet 2016 à 18:33

    Daisy.exe*s'approche*

    144
    Samedi 9 Juillet 2016 à 18:50

    déstress,Yoshi! Puisque,je te dis que.... *gerbe du sang*

    Yoshi:TAILS! BOUGE PAS JE VAIS PRÉVENIR KNUKCLES,MARIO ET BOWSER!!!! *Appel Mario*

    Mario: Allô?

    Yoshi:Mario!C'est Tails!

    Mario:Yoshi? Quoi Tails à eu un problème??

    Yoshi:OUI!!,LUIGI LUI A PLANTER UN COUTEAU DANS SON VENTRE ET Y'A DU SANG PARTOYT DANS SA MAISON!! 

    Mario: ET??

    Yoshi: il gerbe du sang sans s'arrêer...  -_-'

     

    145
    Samedi 9 Juillet 2016 à 18:51

    déstress,Yoshi! Puisque,je te dis que.... *gerbe du sang*

    Yoshi:TAILS! BOUGE PAS JE VAIS PRÉVENIR KNUKCLES,MARIO ET BOWSER!!!! *Appel Mario*

    Mario: Allô?

    Yoshi:Mario!C'est Tails!

    Mario:Yoshi? Quoi Tails à eu un problème??

    Yoshi:OUI!!,LUIGI LUI A PLANTER UN COUTEAU DANS SON VENTRE ET Y'A DU SANG PARTOYT DANS SA MAISON!! 

    Mario: ET??

    Yoshi: il gerbe du sang sans s'arrêer...  -_-'

     

    146
    Samedi 9 Juillet 2016 à 18:53

    Daisy.exe*frappe à la porte*

    147
    Samedi 9 Juillet 2016 à 18:54

    (Sa me gave la verdion mobile....sa envoie le message 2 fois....)

    148
    Samedi 9 Juillet 2016 à 18:55

    (tu as qu'à fermé l'onglet)

    149
    Samedi 9 Juillet 2016 à 18:57

    Yoshi:*va ouvrir* Daisy.exe??

     

    Qu'est qui se pas.....

    Yoshi: euh rien,je t'ai amener une bassine pour que tu évite de gerber paryout car y'a un bain de sang dans ton salon!

    A bah désol.... *gerbe*

    150
    Samedi 9 Juillet 2016 à 18:57

    Daisy.exe*te regarde*

    151
    Samedi 9 Juillet 2016 à 18:58

     (Nan j'ai compris, j'appuie plusieurs fois sur le envoyer,car je croyais qu'il était long,mais non...)

    152
    Samedi 9 Juillet 2016 à 19:01

    ........

    Yoshi: ........... t'as mis du sang partout! Mario va arriver!

    Okay.........

    153
    Samedi 9 Juillet 2016 à 19:02

    Daisy.exe: je savait pas qu'on pouvait cracher autant de sang '-'

    154
    Samedi 9 Juillet 2016 à 19:19

    Yoshi: .... Euh....  sa dépend...

    Mario: Super AHHHHHHHHH! Du sang partout!!!!

    Bowser: j'en connais un qui c'est fait touché par Luigi.exe.....

    GRRRR Bowser si je pouvais te frapper je l'aurais fait..... mais je suis à bout de force........

    Bowser: mais t'es méchant,Tails.... mais au moins tu peux pas me taper ^.^'

    -.- laisse moi respirer! *inspire et expire* 

    Bowser:Pourquoi?

    Parce que,je me sens de moins en moins bien et je perd de l'énergie!! -_-

    155
    Samedi 9 Juillet 2016 à 19:22

    Daisy.exe*déchire sa robe pour faire des bandages*

    156
    Samedi 9 Juillet 2016 à 19:33

    Mario:EGGMAN!!!!

    Eggman:oui?

    Mario: c'est de votre faute à toi et Knukcles!

    Knukcles:Quoi!!!!

    Ouais,désolé Knukcles.....

    Mario:Quand toi et Eggman vous êtes venus avec Tails,vous avez fait un fuck à Sonic.exe et c'est comme sa que les ennuis commençant!!!Sonic est venus et tout les autres aussi! JE CROIS QUE VOUS DEVEZ DES EXCUSES A SONIC!!

    Knukcles et Eggman:QUOI!ALORS LA! HORS DE QUESTION!!

    157
    Samedi 9 Juillet 2016 à 19:36

    Daisy.exe: sachez que Sonic.exe est complètement indifférent à cette histoire. Ca lui ait passé au-dessus des épines

    158
    Samedi 9 Juillet 2016 à 19:42

    Mario: NON ce sont eux les coupables!!!!

    ................ -.- cette histoire ne sera jamais fini... *se lève* Je vais me reposer dans ma chambre.....

    Yoshi: je t'accompagne,au cas où tu viendrais à faire un malaise ou autre trucs....

    Si tu veux..........

    159
    Samedi 9 Juillet 2016 à 19:44

    Daisy.exe*regarde Mario*

    160
    Samedi 9 Juillet 2016 à 19:49

    Knukcles: Roahlala juste pour sa!

    Mario:pfffffffff

    Bowser:*regarde dehors et aperçoit Sonic.exe* Mario!

    Mario: Quoi!

    Bowser: I LOVE YOU ^.^

    Mario: Whut........NOPE '-' 

    Bowser: *,x,*

    161
    Samedi 9 Juillet 2016 à 19:52

    Sonic.exe*devant la porte*

    162
    Samedi 9 Juillet 2016 à 19:57

    Okay.. bon alors je vais voir Tails si il va mieux ^_^

    Yoshi: AH NON! Tails veut être seul!! il veut bien qu'on reste ici pour discuter mais il veut personne dans sa chambre...

    Bowser: Et qui te l'as dit, hein?

    Yoshi: Bah...Tails ù_ù

    163
    Samedi 9 Juillet 2016 à 20:07

    Sonic.exe*vous regarde*

    164
    Samedi 9 Juillet 2016 à 20:38

    Bowser: *met ses lunettes*

    Yoshi,Mario et Knukcles: O_O *regardent Sonic.exe*

    165
    Samedi 9 Juillet 2016 à 20:55

    Sonic.exe: quoi? Vous avez avez jamais vu un hérisson?

    166
    Samedi 9 Juillet 2016 à 21:07

    Knukcles: bah si.....

    Yoshi: Je vais aller voir Tails XD et Sonic,fait pas attention à tout ce sang par terre qui baigne le salon -_-''

    Mario:...........*siffle*

    167
    Samedi 9 Juillet 2016 à 21:09

    Sonic.exe*regarde la sang* ah oui '-'

    168
    Samedi 9 Juillet 2016 à 21:35

    Yoshi: *toque*Tails sa va mieux?

    Bof,pas vraiment......*lit un livre*

    Yoshi: t'as vraiment fait fort.....

    Roah,sa va,je m'y attendait pas....-.-

    Yoshi:Moi non plus......-_-'

    Mais sinon je ne crache plus de sang ^_^ sa me soûler!

    Yoshi:Ouais,mais sinon t'as encore du sang qui coule de ton ventre.....

    J'y peux rien.......

    Yoshi:tu t'es mis du sang partout,abrutis....

    Ah désolé,j'avais une grosse douleur qui est venue... '-'

    Yoshi: ^_* mais sinon tu t'ai bien vider..

    Ah..... 

    Yoshi: mes chaussures sont carrément rouge maintenant........

    Désolé.....*A*

    169
    Samedi 9 Juillet 2016 à 21:40

    Sonic.exe*regarde Yoshi*

    170
    Samedi 9 Juillet 2016 à 21:46

    Ouais,sinon...

    Yoshi:Rien de spécial...

    ù_ù

    Yoshi:Qu'ont t-ils dit au infos?

    Qui? La team Chaotix?

    Yoshi:Oui.......

    Pff,juste que ils veulent résoudre le problème du temps... Mais sa sert à rien...*s'étire*

    171
    Samedi 9 Juillet 2016 à 21:47

    Daisy.exe: le problème du temps?

    172
    Samedi 9 Juillet 2016 à 21:51

    Yoshi: Oui,apparament il y'a eu du mauvais temps... le temps était magnifique mais après.... Le ciel est devenue gris voir noir et l'eau rouge sang....

    173
    Samedi 9 Juillet 2016 à 21:52

    Sonic.exe: intéressant

    174
    Samedi 9 Juillet 2016 à 21:55

    Yoshi et moi: Sa vous intéresse? O_o

    175
    Samedi 9 Juillet 2016 à 21:57

    Yoshi et moi: Pour vous c'est cool mais nous....

    Nope

    Yoshi: pis si sa continue va y'avoir que des creepys et autres truc glauques....

    Comment-sa???

    Yoshi:Bah... en fête on pourrait avoir des ennuis....

    Juste par un stupide temps trop sombre....-.- *soupir*

    176
    Samedi 9 Juillet 2016 à 21:58

    Sonic.exe: c'est la Dark Hill. Une version alternative de la Green Hill^^

    177
    Samedi 9 Juillet 2016 à 22:17
    Yoshi:Dark hill??... Green hill sa veut dire les colline verte mais dark hill, Tout les habitants meurent.. non?

    Oui mais nous,contrairement au monde de Mario,c'est tu meurt,et tu ressuscite pas...

    Yoshi:SRX?O_O

    Ouais, on a pas de champi 1up comme vous,vous mourez,et vous contrairement à nous,vous ressuscité...

    Yoshi: Oh purée....
    178
    Samedi 9 Juillet 2016 à 22:18

    Sonic.exe: on me meurt pas vraiment dans la dark hill. Là-bas, ce n'est qu'un éternel recommencement

    179
    Samedi 9 Juillet 2016 à 22:23
    Yoshi: Ouais en gros,Sonic doit tout faire pour toux vous tuer????
    Vector:*s'incruste*
    Hé!T'AS PAS TOQUÉ!!
    Vector:désolé...
    180
    Samedi 9 Juillet 2016 à 22:27

    Sonic.exe: c'est plus compliqué

    181
    Samedi 9 Juillet 2016 à 22:29

    Vector:Whut,c'est qui lui*pointe Sonic.exe du doigt*

    Espio:*apparait*.....

    Charmy:SALUT!!!!

    182
    Samedi 9 Juillet 2016 à 22:33

    Sonic.exe*regarde Vector*

    183
    Samedi 9 Juillet 2016 à 22:37

    Euh... t'es sérieux??? SA SE VOIT POURTANT TRÈS BIEN,NON!!!!

    Espio*murmure à Charmy* Wow,Tails n'est pas très content....

    Vector:Oh..................bah non....

    Moi,Espio,Charmy et Yoshi: C'EST SONIC! C'EST JUSTE QU'IL A CHANGER!!!

    184
    Samedi 9 Juillet 2016 à 22:41

    Sonic.exe: appelez-moi Sonic.exe

    185
    Samedi 9 Juillet 2016 à 22:49

    Nous 4: *tombent par terre*

    Vector: je ne l'avais pas reconnu....

    Bowser:*viens nous voir* Tails tu serais mieux en Tails Doll!

    Boucle la.... ù_ù

    Vector: Oh désolé de ne pas t'avoir reconnu *met sa main sur l'épaule de Sonic.exe*

    Un conseil d'ami,Vector!

    Vector:Quoi?

    enlève le casque de Vector et lui cri* ENLÈVE TA MAIN DE L'ÉPAULE DE SONIC.EXE!!!!!

    Vector:...... j'ai mal à,mon oreille...

    Ta vraiment cru que j'ai une place au coté des creepy????

    Bowser:Bah.. oui....

    186
    Samedi 9 Juillet 2016 à 22:51

    Sonic.exe: il peut m'approcher sans problème vu que je suis encore très calme u_u

    187
    Samedi 9 Juillet 2016 à 23:02

    Bowser*se moque de moi

    *prend un couteau qui était sur ma table,et regarde bowser* SI TU TE LAFERME PAS DANS LES 10 SECONDES À VENIR,TU PEUX FAIRE TES PRIÈRE!!! :D

    Bowser:NOOOOOOOOOOOOOOOOOOOO * s'éloigne de moi* :<

    188
    Samedi 9 Juillet 2016 à 23:03

    Sonic.exe*te regarde* un problème mec? ê_e

    189
    Samedi 9 Juillet 2016 à 23:12

    Bowser:........ 

    Yoshi:.....toi,t'as du mal à te contrôler!

    * relâche le couteau* Désolé.. :(

    Bowser: *se remet à côté de moi,méfiant* BOuh!

    Tu crois vraiment que j'ai peur....

    Mario: .. Oh tu veux pas tuer Bowser?

    Bowse:NON*tremble*

    Non... je pense à un truc!

    Yoshi: À quoi?

    *se lève* Aller dehors pour me détendre....

    Yoshi:Okay

    190
    Samedi 9 Juillet 2016 à 23:16

    Daisy.exe*regarde Bowser*

    191
    Samedi 9 Juillet 2016 à 23:26

    Mario: En parlant de Tails..Vous trouvez pas qu'il est bizzar,ces temps-ci?

    Yoshi:Ouais.... Il.doit se sentir mal...

    Knukcles:Ouais mais justement quel est la raison??

    Bowser:VOULOIR ME TUER!!!*rester figer*

    Yoshi:Mais d'habitude Tails est heureux mais la....

    Mario:Mais non,c'est par accident.....Bowser!

    Bowser: Ouais mais il faisait une tête à vraiment me tuer....

    Yoshi:Sa se fait pas.... on parle derrière son dos.....

    192
    Samedi 9 Juillet 2016 à 23:28

    Daisy.exe*fixe toujours Bowser*

    193
    Samedi 9 Juillet 2016 à 23:33

    Mario: Je vais aller lui parler!Bowser tu viens avec moi?

    Bowser: pour le tabasser et me venger...OUI!

    Mario:NON,TU TAPE PAS TAILS!

    Bowser:Ah et lui il peut me taper.. et pas moi.. bah  bravo la vengeance chez MR.Mario......

    Mario:MAIS C'EST UN ACCIDENT,TU VA PAS LUI EN VOULOIR!! IL C'EST LAISSER EMPORTER!!

    194
    Samedi 9 Juillet 2016 à 23:36

    Daisy.exe*fixe toujours Bowser, mais c'est approché de lui on sait pas trop comment*

    195
    Samedi 9 Juillet 2016 à 23:41

    Bowser:*ce demande pk daisy.exe se rapproche de lui*

    Mario:Quelque chose le tracasse! alors je vais essayé de lui enlever ce tracas qu'il garde!

    Knukcles:Bonne chance.... ^.^'*siffle*

    196
    Samedi 9 Juillet 2016 à 23:42

    Daisy.exe*fixe toujours Bowser*

    Sonic.exe*regarde Daisy.exe* tu sais gros plein soupe (Bowser), je partirait à ta place car elle a des envies de meurtres sur toi

    197
    Samedi 9 Juillet 2016 à 23:50

    Bowser: QUOI!NOOOOOOOOOOON!mais c'est ma journée!!!*suit Mario*

    Mario*me retrouve*AH,Tails je t'ai cherché partout....

    Qu'il y'a t'il,Mario?

    Mario: Ben disons que.. J'ai discuter avec les autres...

    À propos de moi..

    Mario:Hum.. oui.... mais franchement,que t'arrive t-il,t'était heureux mais là,tu change,sa sert vraiment à rien de changer,juste pour la seule cause que quelque chose te  tracasse...

    (Doit dormir,a demain)

    198
    Samedi 9 Juillet 2016 à 23:53

    Daisy.exe*se contente de suivre Bowser on sait pas trop comment*

    199
    Samedi 9 Juillet 2016 à 23:57

    Bowser:*nous retrouvent* A L'AIDE!

    (Bon j'y go vraiment XDbonne nuit)

    200
    Samedi 9 Juillet 2016 à 23:59

    (Bonne nuit xD) Daisy.exe*continue de le suivre* pour le roi des koopas, t'es pas courageux ê_e

    201
    Dimanche 10 Juillet 2016 à 09:16

    (Salut)

    Bowser: Ahhhhhhhhhh!

    Mario:Bowser!

    Bowser,que fait tu ici?

    Bowser:C'est Daisy.exe,elle veut me tuer!!! *se met derrière moi*

    Mario et moi:*rigolent* 

    Mais bien-sur!

    Mario:Tant qu'on n'y est,Sonic va vouloir tuer Knukcles.. *rigole encore plus*

    202
    Dimanche 10 Juillet 2016 à 09:21

    Sonic.exe: je suis d'humeur à tuer personne

    203
    Dimanche 10 Juillet 2016 à 09:23

    C'est ton problème! débrouille toi!

    Mario:J'avoue ^_^

    Bowser:svp,aidez-moi!

    Nous 2:NOPE!

    204
    Dimanche 10 Juillet 2016 à 09:26

    Daisy.exe*fixe toujours Bowser*

    205
    Dimanche 10 Juillet 2016 à 09:34

    Bowser: *tremble* Mais pourquoi moi et pas Mario ou Tails???

    Mario:*s'allonge sur l'herbe et pose un parasol au dessus de sa tête* Parce que moi je suis posé!

    206
    Dimanche 10 Juillet 2016 à 09:40

    Daisy.exe*regarde toujours Bowser* car t'es une tête à claque

    207
    Dimanche 10 Juillet 2016 à 09:49

    Bowser: NON!!! *regarde l'eau et plonge dedans* Je suis caché!!!

    Mario:Plouf plouf,Bowser.

    XD

    208
    Dimanche 10 Juillet 2016 à 10:11

    Daisy.exe: je te voit^^

    209
    Dimanche 10 Juillet 2016 à 10:58

    Bowser: NOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOn!

    Bah si ^-^,va dire bonjour à daisy.exe!

    Mario: Elle t'as encore rien fait, alors sa sert à rien de te planquer.... (désolée je jouée à la wii u avec mon ptit frère et je suis de retour sur Pc XD)

    210
    Dimanche 10 Juillet 2016 à 10:59

    Daisy.exe: au pire, je peux essayer de prolonger ton apnée, ça me pose aucun problème^^

    211
    Dimanche 10 Juillet 2016 à 11:01

    Bowser: Non, je préfère rester moi même,comme je suis!!!

     PTDR ^_^''

    Mario: Bon, je dort...

    212
    Dimanche 10 Juillet 2016 à 11:04

    Pff, il à rien pigé,ce gars....

    Mario:.............. M'étonne pas de lui,bouffon!

    Bowser: BOUHAHAHA! *fait les yeux doux à mario*

    Mario: DO WTF!!!!!!!!!!

    213
    Dimanche 10 Juillet 2016 à 11:05

    Daisy.exe*s'approche de Bowser*

    214
    Dimanche 10 Juillet 2016 à 11:07

    *Rigole*

    Mario: Bowser, le bras-cassé,Bowser,le bras-cassé!

    Bowser: So........ I HATE YOU!!!!!!!

    Mario: Oh,Think you,Bowser ^-^

    Bowser: GROUAH........

    Mario: NINTENDO!

    *regarde Mario et Bowser*

    215
    Dimanche 10 Juillet 2016 à 11:14

    Daisy.exe*les regarde aussi*

    216
    Dimanche 10 Juillet 2016 à 11:15

    Mario,c'est hors sujet Nintendo.....

    Bowser: ^-^

    Mario: SO... I LOVE YOU!!!

    Bowser: ...... NOOOOOOOOOOOOOOOOOOOOO!

    217
    Dimanche 10 Juillet 2016 à 11:18

    Daisy.exe*regarde Bowser*

    218
    Dimanche 10 Juillet 2016 à 11:21

    Bowser: HELP,HELP!

    NO!

    Bowser:Please,Tails,Help me...

    NO,NO AND NO!!!!!!!

    (ouais on parle English et fench..)

    219
    Dimanche 10 Juillet 2016 à 11:23

    Daisy.exe: serait-ce la peur qui te rend comme ça?

    220
    Dimanche 10 Juillet 2016 à 11:24

    Bowser: Qui????

    ..........?

    (Je m'amuse à faire Daisy.exe et sonic.exe ensemble et Peach et Tails qui se sentent mal XD)

    221
    Dimanche 10 Juillet 2016 à 11:29

    (XD)  Daisy.exe: c'est à toi que parle gros koopa

    222
    Dimanche 10 Juillet 2016 à 11:31

    Bowser:............. QUOI??????

    ...... PFF IMBECILE!!

    223
    Dimanche 10 Juillet 2016 à 11:36

    Daisy.exe: reconnaît que tu as peur

    224
    Dimanche 10 Juillet 2016 à 11:39

    ET LUI LA! *me regarde* IL A PËUR AUSII! DONC........

    Mario: Espèce de koopa Obèse!!

    225
    Dimanche 10 Juillet 2016 à 11:43

    Daisy.exe: tssss x)

    226
    Dimanche 10 Juillet 2016 à 11:45

    Mario: ^_^

    Bowser:GRRRRRRRRR ATTEND,TOI TU VAS SOUFFRIR!

    Ouais,c'est vrai sa, qu'est ce que ta manger pour être aussi obèse que sa,hein?

    Mario: T'es plus gros que moi et Eggman!!

    Bowser: GGGGGGRRRRRRRRRRRRRRRRRR JE MANGE DES FRUITS!

    Pffff* rigole* c'est Knukcles qui mange des fruits, pas toi....

    Mario: Ouais,toi tu mange du porc...... XD

    Mario:T'exagère....

    227
    Dimanche 10 Juillet 2016 à 11:52

    Daisy.exe*attrape Bowser par la queue*

    228
    Dimanche 10 Juillet 2016 à 11:53

    Bowser:QUOI!

    Mario: *s'éloigne de bowser*

    229
    Dimanche 10 Juillet 2016 à 12:02

    Daisy.exe*tire sur la queue*

    230
    Dimanche 10 Juillet 2016 à 12:05

    Bowser:LACHE MOI!!!!

    231
    Dimanche 10 Juillet 2016 à 12:26

    Daisy.exe: nan

    232
    Dimanche 10 Juillet 2016 à 12:27

    Bowser: ELLE VA ME TUER, OUINNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

    espèce de bébé!!!

    Mario: Même Cream qui a 6 ans, elle pleure pas.....

    233
    Dimanche 10 Juillet 2016 à 12:29

    Daisy.exe: je vais t'apprendre à faire de l'apnée, nuance^^

    234
    Dimanche 10 Juillet 2016 à 12:30

    Bowser:.... NOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOON!

    Knukcles et Yoshi:*nous retrouvent* XD on a tout entendu PTDR! ^ô^

    235
    Dimanche 10 Juillet 2016 à 12:36

    Daisy.exe*ignore les cris de bowser*

    236
    Dimanche 10 Juillet 2016 à 12:39

     ^.^ *siflle*

    Mario: ^ô^

    237
    Dimanche 10 Juillet 2016 à 12:44

    Daisy.exe*tire bowser par la queue*

    238
    Dimanche 10 Juillet 2016 à 12:45

    Bowser:*réfléchit*

    239
    Dimanche 10 Juillet 2016 à 12:52

    Daisy.exe*l'emmène vers un point d'eau*

    240
    Dimanche 10 Juillet 2016 à 12:53

    Bowser: *s'évanoui*

    Mario et Moi: POUHAHAHAHA *rigolent*

    241
    Dimanche 10 Juillet 2016 à 13:30

    Daisy.exe*regarde Bowser*

    242
    Dimanche 10 Juillet 2016 à 16:34

    (désolée du retard, c'est ma new 3ds... elle avait péter un plomb)

    Bowser: C'est la fête

    Euh..ouais.......

    Mario:D'accord,fait la fête......

    Yoshi:*Yoshi dance*

    Houla.. il se sent plus,lui.... *regarde Yoshi*

    243
    Dimanche 10 Juillet 2016 à 16:35

    Daisy.exe*regarde Yoshi*

    244
    Dimanche 10 Juillet 2016 à 16:38

    Bon,deux seconde ^-^ *prend Yoshi*

    Yoshi: *,A,*

    Arrête de dancer! s'il te plait!

    Yoshi:................!

    Mario:Quoi? Est ce que Snake est parmi nous?

    Yoshi: Un masque!

    NON! YOSHI, N'Y TOUCHE PAS!!!!!!

    245
    Dimanche 10 Juillet 2016 à 16:39

    Daisy.exe*soupir*

    246
    Dimanche 10 Juillet 2016 à 16:43

    Yoshi: m'en fiche! *touche le masque*

    Purée... ce qu'il ne m'écoute jamais ce dino.........

    Yoshi: *porte le masque,me regarde et essai de gober ma tête*

    AH NONARRETE!!!!

    Mario:ù_ù *regarde Yoshi* Bon,il est fou........ *essai de me me dégager de la bouche de yoshi*

    Je suis pas de la nourriture!!!!!!!!!!

    247
    Dimanche 10 Juillet 2016 à 16:44

    Daisy.exe*va vous aider*

    248
    Dimanche 10 Juillet 2016 à 16:47

    Bowser: *se réveille* Que se passe t-il?

    Mario: Yoshi veut bouffer Tails sans aucune raison.....

    Yoshi: Si! t'es un poulet!

    JE SUIS PAS UN POULET! MAIS UN RENARD!!!!!!!!!

    Luigi.exe: *nous voient et se moque de moi* Tails le poulet XD

    TOI BOUCLE LA!

    249
    Dimanche 10 Juillet 2016 à 16:49

    Daisy.exe*prend Yoshi par la queue*

    250
    Dimanche 10 Juillet 2016 à 16:52

    Yoshi: *frappe Daisy.exe et me gobe*

    Mario:..... ZUT! O_O Tails, sa va?

    ................... Ouais........ *bloquer dans le corps de yoshi*

    Yoshi: *pond un oeuf*

    Mario:....... T'es où?

    Là! Dans un oeuf Yoshi.....

    251
    Dimanche 10 Juillet 2016 à 16:53

    Daisy.exe*regarde l'oeuf*

    252
    Dimanche 10 Juillet 2016 à 16:58

    **prend son nuchaku et casse l'oeuf* Beurk.....

    Mario: Doctor Eggman ^_^

    Eggman: A NON! Docteur Mario ^_^

    Dr.Mario: Hey,it me...

    Knukcles: Mario< Dr.Mario?

    Dr.Mario: Attend je m'en occupe de lui!

    AH NON! PAS TOI! LA DERNIERE FOIS,TU M'AVAIT FAIT UNE PIQURE JUSTE PARCE QUE J'AVAIS UN RHUM.........

    253
    Dimanche 10 Juillet 2016 à 17:02

    Daisy.exe: -_-

    254
    Dimanche 10 Juillet 2016 à 17:06

    Knukcles: Ouais,Tails dit vrai et tu vas lui faire quoi,hein?

    Mario: Chirugien!

    QUOIIIIIIIIIIIIIIIIIIII! *se lève choqué* MAIS je suis pas déformer!

    Dr.Mario: Allons-bouge pas!

    NOOOOOOOOOON, JE REFUSE, je veux pas changer......

    Dr.Mario: *sort un tronsonneuse*

    Knukcles: Mais il est fou??? D'où on chirugie quelqu'un avec une tronssonneuse?

    C'est du Dr.Mario!!!!! AHHHHHHHHHHHHH NON!

     

    255
    Dimanche 10 Juillet 2016 à 17:06

    Daisy.exe: Dr.Mario!

    256
    Dimanche 10 Juillet 2016 à 17:14

    Dr.Mario:*ignore et me paralyse*

    Purée.............

    Dr.Mario:*me chirugie*

    Yoshi:*réussi à enlever le masque* Que ce passe t-il?

    MARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRIO!

    Knukcles: Oh,Zut...

    Bowser:*me regarde* Ah bah ce que je voulais ^-^

    Yoshi: MAIS QUOI?

    IL M'AS CARREMENT CHANGER.....

    Yoshi: EN.... EN TAILS DOLL........

    MARIOOO!

    Mario: *enlève sa tenue* Voilà ^_^

    *le regarde*........*A* Pourquoi t'as fait sa?

    Mario: Bah quoi??

    Roahlala ,tant pis je vais rester comme sa......

    257
    Dimanche 10 Juillet 2016 à 17:16

    Sonic.exe: on dirait une poupée x)

    258
    Dimanche 10 Juillet 2016 à 17:20

    Pas de commentaire,Sonic.exe stp.....

    Mario:..........

    Knukcles:..... Du coups sa fait Tails en moins...

    Euh.. c'est plus Tails mais Doll.... Merci....

    Yoshi:....... Mario a encore fait des bêtises^_^

    Mario: *me regarde avec des yeux doux*

    Dégage! je veux pas d'un psychopathe près de moi.....

    259
    Dimanche 10 Juillet 2016 à 17:21

    Sonic.exe: pourquoi on pourrait pas t'appeler "Tails Doll"?

    260
    Dimanche 10 Juillet 2016 à 17:27

    .......Si tu veux.

    Mario:D'accord *s'éloigne de moi*

    Bowser: Bouhaha,qui veux jouer à la poupée?

    Euh..  Bowser... je suis pas un jouet.....

    Knukcles: Non,t'es une poupée XD

    261
    Dimanche 10 Juillet 2016 à 17:28

    Sonic.exe: je suis sûr que Tails Doll a le courage de vous attaquer

    262
    Dimanche 10 Juillet 2016 à 17:31

    Ouais,pour une fois que je te donne raison,Sonic.exe

    263
    Dimanche 10 Juillet 2016 à 17:44

    Sonic.exe: je sais^^

    264
    Dimanche 10 Juillet 2016 à 17:45
    265
    Dimanche 10 Juillet 2016 à 17:46

    Daisy.exe*te regarde*

    266
    Dimanche 10 Juillet 2016 à 17:47

    Mario:Super Mario Sun

    Super Mario,Boucle la! *lui coupe la parole*

    267
    Dimanche 10 Juillet 2016 à 17:51

    Daisy.exe: tu sais Tail Doll, avec une tête comme ça, tu pourrais être des notres

    268
    Dimanche 10 Juillet 2016 à 17:55

    Ouais... pourquoi pas...

    Yoshi: Bravo,Dr.Mario......

    Dr.Mario: Je suis un gén....

    Knukcles: UN GROS BOUFFON!

    Bowser: The Echidna n'as pas tort.....

    Knukcles: MON NOM EST KNUKCLES! PAS THE ECHIDNA!!!!!!

    269
    Dimanche 10 Juillet 2016 à 17:58

    Sonic.exe: bienvenue parmi nous Tails Doll^^

    270
    Dimanche 10 Juillet 2016 à 18:03

    Merci ^^

    Luigi.exe:*s'incruste* Il est mort Tails?

    Roah pas lui......... -.-'

    Yoshi:Nope!

    Dr.Mario: Je suis chirugiens,médecin...

    Non! C'était moi.......

    Luigi.exe:???????

    Knukcles: Dr.Mario l'as changé.......

    Yoshi: il avait pas vraiment de blessure... Mais..

    Knukcles: Oh,hé, c'est ta faute Yoshi! Si t'avais écouté Tails doll, rien de sa se serai passé!!!!

    Yoshi: *Carameldancel*

    Knukcles: il va toujours faire la fête cette abrutis....

    271
    Dimanche 10 Juillet 2016 à 18:08

    Daisy.exe*regarde Luigi.exe*

    272
    Dimanche 10 Juillet 2016 à 18:09

    Luigi.exe: Quoi???????

    273
    Dimanche 10 Juillet 2016 à 18:12

    Daisy.exe: je voudrait juste te dire que Tails Doll est maintenant des notres

    274
    Dimanche 10 Juillet 2016 à 18:13

    Luigi:Cool un membre en plus ^^

    275
    Dimanche 10 Juillet 2016 à 18:17

    Daisy.exe: ouais

    276
    Dimanche 10 Juillet 2016 à 18:21

    Dr.Mario: *répète sans arrêt son nom et prénom*

    Ouais bah Dr.Mario ferait mieux de se taire ou sinon je vais l'amener dans son cabinet...

    Dr.Mario: No!

    277
    Dimanche 10 Juillet 2016 à 18:22

    Daisy.exe*cherche un poêle*

    278
    Dimanche 10 Juillet 2016 à 18:25

    Yoshi: j'ai faim...

    Bowser: Bowser le chef s'en occupe *prend ce que Daisy.exe recherche et la pose sur l'herbe et part chercher d'autres ingrédiants*

    279
    Dimanche 10 Juillet 2016 à 18:26

    Daisy.exe*prend la poêle et va assommer Mario avec*

    280
    Dimanche 10 Juillet 2016 à 18:30

    *se moque de Mario* ^^ il va se faire défoncer, bon au moins il va arrêter, sa  casse les oreilles!

    Yoshi J'AI FAIM!

    arrête de te plaindre,Yoshi -_-

    281
    Dimanche 10 Juillet 2016 à 18:31

    Daisy.exe*assomme Mario*

    282
    Dimanche 10 Juillet 2016 à 18:34

    Dr.Mario: *assomé* Oh Mamamia....

    Ouais, il est assomé ^^

    Yoshi: je peux avoir la poê^le,Daisy.exe,si te plait.

    Knukcles: n

    Bon, je crois qu'on va l'emmener chez un doc...

    Eggman: Pas moi,Pas moi! J'ai pas envie de finir comme Tails

    Yoshi: Doll

    Eggman: Oui, bon je dis ce que je veux,genre Sonic au lieu de Sonic.exe..

     

    283
    Dimanche 10 Juillet 2016 à 18:37

    Daisy.exe*laisse tomber la poêle*

    284
    Dimanche 10 Juillet 2016 à 18:39

    Eggman: *prend la poêle et fait une omelette*

    Yoshi: Omelette pour YOSHI! *mange l'omelette*

    Knukcles: Je m'en fiche j'ai mes fruits, pour être fort...

    285
    Dimanche 10 Juillet 2016 à 18:40

    Daisy.exe*mange une pomme*

    286
    Dimanche 10 Juillet 2016 à 18:41

    Yoshi:Soni.exe aime encore les hot dog au chili???

    Knukcles:..... *mange ses fruits*

    287
    Dimanche 10 Juillet 2016 à 18:43

    Sonic.exe: je préfère la viande

    288
    Dimanche 10 Juillet 2016 à 18:43

    (je vais mangée, à toute ;) )

    289
    Dimanche 10 Juillet 2016 à 18:44
    290
    Dimanche 10 Juillet 2016 à 19:09

    (re)

    Yoshi: T'es carnivore!!!!

    Knukcles:*tombe par terre* non sens blague!

    *siffle*

    291
    Dimanche 10 Juillet 2016 à 19:16

    Sonic.exe: j'ai dit que je préférait la viande. Pas que c'était la base de mon alimentation

    292
    Dimanche 10 Juillet 2016 à 19:18

    Yoshi: Alors c'est quoi la base de ton alimentation,hein?

    Knukcles: .........

    Eggman: c'est qu'il aime se goinffrer de chili ^-^

    Knukcles: mais non,tête d'oeuf......

    293
    Dimanche 10 Juillet 2016 à 19:19

    Sonic.exe: je suis omnivore

    294
    Dimanche 10 Juillet 2016 à 19:23

    Yoshi:Oh tu mange de tout alors ^_^

    Knukcles: Carnivore c'est tu mange que de la viande

    Herbivore c'est quand tu mange que de la végétation et t'aime pas la viande...

    295
    Dimanche 10 Juillet 2016 à 19:30

    Daisy.exe: il y aussi les insectivores, les granivores

    296
    Dimanche 10 Juillet 2016 à 19:33

    Knukcles:Beurk...

    Yoshi:C'est dégoutant...

    297
    Dimanche 10 Juillet 2016 à 19:57

    Daisy.exe: de quoi? Les insectivores?

    298
    Dimanche 10 Juillet 2016 à 19:58

    Yoshi:Oui.... :(

    Knukcles:......

    299
    Dimanche 10 Juillet 2016 à 20:00

    Daisy.exe: franchement, j'ai déjà mangé des insectes, et c'est pas dégueu

    300
    Dimanche 10 Juillet 2016 à 20:05

    Knukcles:*a envie de vomir*

    Yoshi:*comme Knukcles*

    Bowser:Et les verres de terres c'est très bon ^_^

    Sa dépend les quels.. '-'

     

    301
    Dimanche 10 Juillet 2016 à 20:07

    Daisy.exe: je préfères les sauterelles grillées

    302
    Dimanche 10 Juillet 2016 à 20:09

    Bowser:Moi mes verres de terres,miam

    Oui,on a compris que t'es obsédé par tes verres de terres...

    Knukcles: Personne aiment les araignées,ici?

    Yoshi:Ah,mais t'es dégoutant,Knukcles...

    303
    Dimanche 10 Juillet 2016 à 20:11

    Daisy.exe: quoi? Ces monstres tueurs au pattes velues? Brrr...

    304
    Dimanche 10 Juillet 2016 à 20:19

    Pourquoi,Toi tu les aiment bien ces bestioles???

    Knukcles: Non XD

    Yoshi:WINWINWINWOUH!

    305
    Dimanche 10 Juillet 2016 à 20:24

    Daisy.exe: je DETESTE les araignées

    306
    Dimanche 10 Juillet 2016 à 20:33

    Yoshi:J'imiter pas les araignées... j'aime pas ces bestioles.. ils ont pas bon goût!

    Heureusement que tu les mangent pas... ^^

    Yoshi:Si,j'en ai déjà manger,est ah j'ai le goût qui revient.....

    307
    Dimanche 10 Juillet 2016 à 20:34

    Daisy.exe: ah bon?

    308
    Dimanche 10 Juillet 2016 à 20:36

    Yoshi:C'est écurent...... Pouah....

    Knukcles: Une bien belle bien noire?

    Arrête,Knukcles! :( sa m'écure

    309
    Dimanche 10 Juillet 2016 à 20:44

    Daisy.exe: c'est moche en plus

    310
    Dimanche 10 Juillet 2016 à 20:45

    Ouais c'est vrai...

    Bowser:Et les scorpions?

    311
    Dimanche 10 Juillet 2016 à 20:53

    Daisy.exe: c pas mauvais avec un peu de sel '-'

    312
    Dimanche 10 Juillet 2016 à 20:56

    Yoshi: Ah ouais! Je confirme par contre faut le tuer avant de le manger....

    Tu mange de tout,toi!

    Yoshi:Euh.......

    Knukcles: XD

    313
    Dimanche 10 Juillet 2016 à 20:56

    Daisy.exe: et enlever l'aiguillon

    314
    Dimanche 10 Juillet 2016 à 20:59

    Yoshi: MIAM! SA ME DONNE FAIM ^^

    Encore?!

    Knukcles:M'étonne pas de lui.. XD

    -_-'

    315
    Dimanche 10 Juillet 2016 à 21:06

    Daisy.exe: tu ne fait que manger '-'

    316
    Dimanche 10 Juillet 2016 à 21:13

    Yoshi:*part chasser*

    317
    Dimanche 10 Juillet 2016 à 21:13

    Daisy.exe*le regarde partir*

    318
    Dimanche 10 Juillet 2016 à 21:18

    Yoshi: *reviens* J'ai trouvée sa ^^

    Knukcles: XD

    319
    Dimanche 10 Juillet 2016 à 21:24

    Daisy.exe*s'en fiche*

    320
    Dimanche 10 Juillet 2016 à 21:32

    Yoshi: *mange*

    Knukcles: Bon je vais y aller....

    Bowser:Ouais on se retrouve plus tard...

    Yoshi:*prend Mario toujours assomé et s'en vont* A plus!

    Okay...

    321
    Dimanche 10 Juillet 2016 à 21:33

    Daisy.exe: on est seul '-'

    322
    Dimanche 10 Juillet 2016 à 21:36

    Mais non,y'a Sonic.exe et Luigi.exe avec nous. ;)

    323
    Dimanche 10 Juillet 2016 à 21:37

    Daisy.exe*regarde dehors* et E-beth qui arrive

    324
    Dimanche 10 Juillet 2016 à 21:48

    Ah la fille qu'on avait rencontrer euh.... y'a quelques heures..

    325
    Dimanche 10 Juillet 2016 à 21:51

    Daisy.exe: la cyborg, oui

    326
    Dimanche 10 Juillet 2016 à 21:54

    Yep ^_^'

    327
    Dimanche 10 Juillet 2016 à 21:57

    E-beth*se pose sur le sol*

    328
    Dimanche 10 Juillet 2016 à 22:02

    Bonjour^^

    329
    Dimanche 10 Juillet 2016 à 22:06

    E-beth: salut^^

    330
    Dimanche 10 Juillet 2016 à 22:07

    Sa va?

    331
    Dimanche 10 Juillet 2016 à 22:11

    E-beth: ouais et toi?

    332
    Dimanche 10 Juillet 2016 à 22:19

    Bien ;)

    Luigi.exe On s'ennuis...

    Ben.. je vais aller m'allonger... *s'allonge dans un hamac*

    333
    Dimanche 10 Juillet 2016 à 22:20

    Daisy.exe*mange une autre pomme*

    334
    Dimanche 10 Juillet 2016 à 22:23

    Tu vas en mangée combien de pommes,Daisy.??

    335
    Dimanche 10 Juillet 2016 à 22:25

    Daisy.exe: je sais pas '-'

    336
    Dimanche 10 Juillet 2016 à 22:28

    Luigi.exe: *s'amuse avec sonic.exe je sais pas à quoi,mais il s'amuse*

    *Les regardent et prend un bonbon*

    337
    Dimanche 10 Juillet 2016 à 22:29

    Sonic.exe*semble s'amuser autant que si il regardait une machine à laver à l'arrêt*

    338
    Dimanche 10 Juillet 2016 à 22:34

    Luigi.exe: Bon au moins,y'a pas ce fichu dino vert avec ce porc-épic  avec ce plombier rouge bizzar qui me sert de frère et le roi des trouillards..............

    Je sais même pas pourquoi Bowser c'est incruster.......

    Luigi.exe: Pour cassé l'ambiance... Comme d'habitude...

    339
    Dimanche 10 Juillet 2016 à 22:41

    Daisy.exe: toute façon, il risque pas de revenir vu que si je le voit, je lui apprend l'apnée^^

    340
    Dimanche 10 Juillet 2016 à 22:44

    *rigole*

    Luigi.exe:Ah oui,et c'est qui là bas?

    Le roi de froussard XD

    Bowser:*au loin voit Daisy.exe* VOS BOUCHE! J'AI PAS PEUR DE VOUS 5!!!!! PEUT ETRE QU'A CAUSE DE CE DR.MARIO ON C'EST TOUS EMBROUILLER MAIS J'AI PAS PEUR DE VOUS!! *fait son fière*

    Luigi.exe: Et si je sors mon couteau et je te fonce dessus! Sa te feras quoi?

    341
    Dimanche 10 Juillet 2016 à 22:47

    Daisy.exe*s'approche de Bowser on sait pas trop comment*

    342
    Dimanche 10 Juillet 2016 à 22:49

    Bowser:Quoi!!!!! *regarde Daiy.exe*

    Luigi.exe: J'ai jamais vu un Bowser faire de l'apnée *rigole*

    XD

    Luigi.exe: Et toi,Sonic.exe,t'en as déjà vu un?

    343
    Dimanche 10 Juillet 2016 à 22:53

    Daisy.exe: tu cherches à me provoquer?

    Sonic.exe: nan, c'est assez rare en même temps

    344
    Dimanche 10 Juillet 2016 à 22:54

    Bowser:NAN! Sale peste!!!

    345
    Dimanche 10 Juillet 2016 à 22:58

    Daisy.exe: ok. Tu l'as cherché*sourire très flippant*

    346
    Dimanche 10 Juillet 2016 à 23:01

    Bowser:OH ME GOD,OH ME GOD! *tourne sur lui-même!*

    Euh.... il est taré?????????

    347
    Dimanche 10 Juillet 2016 à 23:03

    Daisy.exe: hein?

    348
    Dimanche 10 Juillet 2016 à 23:05

    *se lève et s'approche de bowser et le touche avec un baton* ....

    Bowser:AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH! SA PIQUE!!!!*hurle*

    Oups... j'ai pris un truc pointu au lieu d'un baton.... désolé ^^'

    349
    Dimanche 10 Juillet 2016 à 23:13

    Daisy.exe*regarde Bowser*

    350
    Dimanche 10 Juillet 2016 à 23:16

    Bowser:Rah! Tu t'es peut être pris Dr.Mario en pleine tête, mais t'es encore plus débile qu'avant,Tails!!!

    M'en fiche!

    Luigi.exe: Alors,t'as pimpé encore plus ta carapace toute moche,Bowser??

    351
    Dimanche 10 Juillet 2016 à 23:18

    Daisy.exe: je pense que Tails Doll a fait exprès

    352
    Dimanche 10 Juillet 2016 à 23:23

     

    Bowser:GRRRRRRRR! Pourquoi te me soule,Tails doll?

    Parce que,tu m'as soulé toutes à l'heure..... Et je te rappel que c'est toi qui voulait que je soit comme sa donc voilà,ton souhait est exaucé! Donc je peux m'amusé à te gaver si je veux ^^.

    Bowser:Non,sa va aller!

    353
    Dimanche 10 Juillet 2016 à 23:33

    (J'y go dormir,bonne nuit ^^)

    354
    Dimanche 10 Juillet 2016 à 23:41

    Daisy.exe: moi aussi je veux jouer (bonne nuit)

    355
    Lundi 11 Juillet 2016 à 10:51
    Bowser: A quoi voulez jouer,hein! Luigi.exe: a t'apprendre à faire de l'apnée ^
    356
    Lundi 11 Juillet 2016 à 10:53

    Daisy.exe*regarde Luigi.exe* t'y arriveras pas. Je suis la plus forte du groupe

    357
    Lundi 11 Juillet 2016 à 13:39

    Bowser:NOOOOOOOOOOOOOOOOOOOOOOOOOOOON *cri*

    *se moque du cri de Bowser*

    Luigi.exe: XD

    358
    Lundi 11 Juillet 2016 à 13:41

    Daisy.exe*sourire bizarre*

    359
    Lundi 11 Juillet 2016 à 13:43

    Bowser:*cour et tourne sur lui même*

    Luigi.exe: Oh allé! Bowser sa va être drôle!

    Bowser:NON!!!!!!!!!!! POUR VOUS OUI MAIS POUR MOI NON!!!!!!! PAS DE L'APNEE! DEJA,C'EST QUOI DE L'APNEE????

    360
    Lundi 11 Juillet 2016 à 13:46

    Daisy.exe: c'est retenir sa respiration sous l'eau u_u

    361
    Lundi 11 Juillet 2016 à 13:47

    Bowser: *plonge dans l'eau* AUREVOIR,JE SUIS CACHER,BOUHAHAHAHA!

    362
    Lundi 11 Juillet 2016 à 13:51

    Daisy.exe*s'approche de lui et lui enfonce la tête dans l'eau*

    363
    Lundi 11 Juillet 2016 à 13:54

    Bowser:*sous l'eau,n'arrive pas à en ressortir*

    Luigi.exe: Il a pas de force ce mec......

    364
    Lundi 11 Juillet 2016 à 13:56

    Daisy.exe*s'assure bien qu'il puisse pas sortir la tête de l'eau* nan, il perd juste ses moyens

    365
    Lundi 11 Juillet 2016 à 14:05

    Luigi.exe: Sa me rappel quelqu'un *regarde Sonic.exe*Quelqu'un qui perd ses moyens quand il est longtemps sous pour la seule cause Qu'il sait pas nager...

    Roah Luigi.exe,t'exagère...

    366
    Lundi 11 Juillet 2016 à 14:13

    Sonic.exe: on a tous des défauts

    367
    Lundi 11 Juillet 2016 à 14:16

    Luigi.exe:Ouais comme Tails doll qui a peur de la foudre...

    Oui bon..... et toi t'en as aussi des défauts....

    368
    Lundi 11 Juillet 2016 à 14:18

    Daisy.exe*fini de noyer Bowser*

    369
    Lundi 11 Juillet 2016 à 14:21

    Bowser: GLOUP GLOUP!!!!!! DEAD!

    Luigi.exe: Oh alors... Bowser tu est mort?

    Bowser:DEAD DEAD DEAD *dit la même chose*

    370
    Lundi 11 Juillet 2016 à 14:22

    Daisy.exe: il est pas mort puisqu'il parle -_-

    371
    Lundi 11 Juillet 2016 à 14:29

    (Je dois y'aller...)

    372
    Lundi 11 Juillet 2016 à 14:30
    373
    Mardi 12 Juillet 2016 à 12:17
    (Salut,je suis encore sur 3ds mon père joue souvent à son pc)
    Bowser: GRRRRRRRRR!KOOPAS,GOOMBAS ATTAQUEZ CES 5 PERSONNES!
    Koopa: ......... *joue aux échec avec un goomba*
    374
    Mardi 12 Juillet 2016 à 12:23

    Daisy.exe: super l'armée^^ EH! VOUS SAVEZ JOUER AUX CARTES? :D

    375
    Mardi 12 Juillet 2016 à 21:25

    Koopa: OUIIIIIIIII! Mais nous attaquez pas,s'il vous plait... :(

    Goomba: On va rien vous faire du tout...

    Koopa: On jouer tranquillement aux échec et maitre Bowser nous a appeler.....

    Goomba: Du coups on a prit notre jeu...

    376
    Mardi 12 Juillet 2016 à 21:28

    Daisy.exe: on pourrait se faire un poker! J'ai un jeu de cartes sur moi!

    377
    Mardi 12 Juillet 2016 à 21:31

    Goomba: Okay...

    378
    Mardi 12 Juillet 2016 à 21:32

    Daisy.exe*sort son jeu de cartes*

    379
    Mardi 12 Juillet 2016 à 21:34

    Koopa et Goomba: *s'installe*

    380
    Mardi 12 Juillet 2016 à 21:34

    Daisy.exe*bat les cartes*

    381
    Mardi 12 Juillet 2016 à 21:36

    Goomba:.......

    Koopa:....

    382
    Mardi 12 Juillet 2016 à 21:38

    Daisy.exe*distribue*

    383
    Mardi 12 Juillet 2016 à 21:40

    Goomba: *regarde ses cartes*

    384
    Mardi 12 Juillet 2016 à 21:50

    Daisy.exe*regarde les siennes*

    385
    Mardi 12 Juillet 2016 à 21:51

    Koopa: Euh.. Honneur aux dames

    386
    Mardi 12 Juillet 2016 à 21:52

    Daisy.exe: vous êtes sur?

    387
    Mardi 12 Juillet 2016 à 22:02

    Goomba:Oui car nous au moins on est poli! Comparer à maitre Bowser..

    388
    Mardi 12 Juillet 2016 à 22:06

    Daisy.exe: je dit ça juste parce que j'ai un bon jeu, mais si vous insistez*sort un carré d'as*

    389
    Mardi 12 Juillet 2016 à 22:08

    Koopa: Et si on perd,tu vas pas nous tuer.....

    390
    Mardi 12 Juillet 2016 à 22:08

    Daisy.exe: maaaaaaaaaaaaaaais naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaan^^

    391
    Mardi 12 Juillet 2016 à 22:11

    Goomba:*sort sa carte: 8 cœurs*

    Koopa: bon à moi *sort une carte: as de trèfle*

    392
    Mardi 12 Juillet 2016 à 22:14

    Daisy.exe: vous savez qu'on joue au Poker, nan?

    393
    Mardi 12 Juillet 2016 à 22:16

    Goomba et Kopa:*lâchent leurs cartes et s'en vont au châ^teau de Bowser*

    Bowser:QUOI! MAIS REVENEZ ICI!

    Luigi.exe: Quels bandes de bras cassés..

    394
    Mardi 12 Juillet 2016 à 22:20

    Daisy.exe: 'pas compris '-'

    395
    Mardi 12 Juillet 2016 à 22:24

    Lol ^^

    Luigi.exe: Pff,n'importe quoi...

    Shadow:*Nous voient*

    396
    Mardi 12 Juillet 2016 à 22:27

    Daisy.exe: tant pis*range ses carte*

    397
    Mardi 12 Juillet 2016 à 22:32

    Luigi.exe: Dommage,tu devais bien t'amusée..

    398
    Mardi 12 Juillet 2016 à 22:33

    Daisy.exe: ouais....

    399
    Mardi 12 Juillet 2016 à 22:36

    Yoshi:* cherche un coin pour dormir*

    Knukcles: ...........

    Shadow:*apparaît devant Knukcles et Yoshi* HUM.....

    Yoshi:YIN YIN YINSHI

    Shadow:......

    Knukcles: Que fais-tu ici,Shadow?

    400
    Mardi 12 Juillet 2016 à 22:44

    Daisy.exe*regarde Shadow*

    401
    Mardi 12 Juillet 2016 à 22:47

    Shadow: J'ai croisé cette imbécile!

    Knukcles: Qui?

    Shadow:.. Amy Rose!!!!

    Knukcles: OH NON! PAS ELLE!!!!!

    Shadow elle était avec Cream,Sally et Cosmo!

    Yoshi:Sally? Cosmo?

    Shadow:Sally est la petite amie de sonic et Cosmo est la petite amie de Tails..

    Knukcles: Mais Cosmo..

    Shadow:Oui,je sais ,mais je sais pas ce qui c'est passé mais elle a réssucitée....

     

    402
    Mardi 12 Juillet 2016 à 22:48

    Sonic.exe: Sally est dans le coin?! Mais je veux pas la voir!

    403
    Mardi 12 Juillet 2016 à 22:52

    C'est une blague......  elles peuvent pas dégagée d'ici???

    Luigi.exe: Depuis quand t'as une petite amie,toi?

    Bah.. euh. depuis qu'elle était censée être morte.......!!!! u_u J'ai pas envie de voir Cosmo.....

    Luigi.exe: elle sais que t'es comme sa?

    Bah non... Justement ...

    Luigi.exe: Attend..... Elle va être choquée si elle te voit....

    Ouais je pense...

    404
    Mardi 12 Juillet 2016 à 22:53

    Sonic.exe: et dire que je pensait m'être débarrassé de ma "copine" -_- j'ai dû oublié un truc

    Daisy.exe: la rupture '-'

    405
    Mardi 12 Juillet 2016 à 23:00

     T'aurais préféré qu'elle meurt aussi....

    Luigi.exe:  XD  pas de bol,les gars...

    Yoshi!

    Yoshi:*viens me voir* Quoi?

    Tu veux bien éloigné Amy et les autres,s'il te plait...

    Yoshi: D'accord ^^,mais parce que c'est toi!

    Merci ^^

    Yoshi:*trouve Amy et les autres* AH AMY!

    Amy:Quoi?

    Cream:Bonjour Mr Yoshi ^^

    Sally et Cosmo: Yoshi???

    Yoshi: Oui ^^ C'est moi :)

    Cosmo: XD

    Amy:Il est où,Sonic?

    Cosmo:Et Tails?

    Sally: *rigole* vous deux alors.... ;)

    Yoshi:Euh ils sont.....; LA BAS *indique un chemin,pas là ou on était*

    Amy:Yoshi.. Est tu en train de nous mentir?

    Yoshi:Non pas du tout ^^

    Amy:Mouais Bon,Cream,Cosmo,vous venez?

    Cosmo et Cream:OUAIS! *suivent Amy*

    Sally: *dans sa tê^te* (hum... je pense que ce soit disant 'Yoshi' cahce quelque chose..)

     

    406
    Mardi 12 Juillet 2016 à 23:03

    Sonic.exe: j'ai pas envie de revivre le calvaire que j'ai eu avec la Sally du Creepy World -_-

    407
    Mardi 12 Juillet 2016 à 23:05

    .....?????

    Luigi.exe:On a qu'a la tuée???

     XD

    Luigi.exe: Par contre t'as 'Copine' se doute de quelque chose,sa se voit à sa tête.... Y'a plus q'ua aidé Sonic.exe puisque Amy et Cosmo sont partie avec Cream ^^'

    Quel journée.... -.-

    408
    Mardi 12 Juillet 2016 à 23:06

    Sonic.exe: tant pis, je vais me débrouiller -_-

    409
    Mardi 12 Juillet 2016 à 23:09

    Luigi.exe:Sûr?

    Yoshi:YIN YIN YINSHI,YIN YIN YINSHI,YIN YIN YINSHI *répète sans cesse la même chose*

    *prend une batte de baseball(comme dans mno article Whut.. xD) et donne un coup à Yoshi*

    Yoshi:AIE.. BOBO NOIX DE COCO

    Whut.... O_O

    410
    Mardi 12 Juillet 2016 à 23:10

    (Je vais dormir,bonne nuit ^-^)

    411
    Mardi 12 Juillet 2016 à 23:10

    Daisy.exe: ok '-'

    412
    Mercredi 13 Juillet 2016 à 10:24

    Yoshi: ..... Tu m'as fait mal!!!!!

    Knukcles: XD

    Ah bah désolé,mais aussi tu me casse les oreilles avec tes Yin yin yinshi trop bizzar....

    413
    Mercredi 13 Juillet 2016 à 10:26

    Daisy.exe: surtout que c'est pas le bruit d'un Yoshi oridnaire

    414
    Mercredi 13 Juillet 2016 à 10:34

    Yoshi: Et alors??? y'a rien de mal la dedans,si?

    Knukcles: C'est que sa casse les oreilles,ton stupide bruit.....

    Yoshi:Pffff

    Knukcls:QUOI,Pff!!!!

    Shadow:*se met entre Yoshi e knuklces* nope,pas de baston!!

    Knukcles: Il a perdu la tête??

    Yoshi: D'habitude il nous laisse se bastonner,mais là oui,il a perdu la tête..

    Shadow: Hum.... J'ai pas perdu la tête,Bandes d'idiots sur pattes!!!!

    415
    Mercredi 13 Juillet 2016 à 10:42

    Daisy.exe*regarde Shadow*

    416
    Mercredi 13 Juillet 2016 à 10:48

    (OH DES YOSHI COMME THEME XD ils sont trop choupi  mdr)

    Shadow:.................

    Knuklces: Bon sinon.... On fait quoi?

    Yoshi:euh........ *regarde sally toujours figée et qu'elle réfléchit toujours*

    Shadow: Qu'est ce qu'elle fait ici,elle!

    Knuklces:Amy voulais absolument voir Sonic...........

    Yoshi:Mais j'ai menti à Amy,Cosmo..

    Shadow:COSMO! Je croyais qu'elle était morte!! GRRRR je vais retourner la tuée! et j'espère que Tails ne sera pas dans mes pattes une seconde fois!

    ............... *regarde shadow*

    Shadow: WHUT! *me voit et sursaute*

    417
    Mercredi 13 Juillet 2016 à 10:50

    (Merci x) et un nouveau nom de blog va avec!) Daisy.exe*regarde Sally de loin*

    418
    Mercredi 13 Juillet 2016 à 10:54

    (Yoshi dance XD)

    Quoi????

    Shadow: Euh... rien... *va voir Knukcles* Me dit pas que c'est Tails...

    Knuklces: Euh.. bah si..

    Shadow:... Mais qu'est ce qui c'est passé?

    Yoshi: Dr.Mario

    Shadow:encore ce type...?

    Yoshi:Ouais...

    419
    Mercredi 13 Juillet 2016 à 10:56

    (Perdu x)) Daisy.exe: c'est un pseudo toubib

    420
    Jeudi 14 Juillet 2016 à 11:28

    Ouais... il m'a carrément changé de tête... J'avais rien,mais c'est tout lui!

    Yoshi:Dr.Mario est égal à Mario! Ils ont tout les deux un problème... ù_ù

    Shadow:Ouais et sa se voit .... t'était normal mais là t'es plus le renard qu'on a connu....

    ...... Bah merci,Shadow....O_O

    Shadow:Désolé.....

    421
    Jeudi 14 Juillet 2016 à 11:43
    Daisy.exe: eh ben Shadow, tu es très subtil u.u
    422
    Jeudi 14 Juillet 2016 à 11:50

    Shadow: *A*

    423
    Jeudi 14 Juillet 2016 à 11:53
    Daisy.exe: ?
    424
    Jeudi 14 Juillet 2016 à 11:57

     Shadow:°o° *regarde Sally qui nous voient* Elle se sent plus elle....

    Yoshi: Je me charge d'elle ^^

    Vas-y,on te regarde!

    Yoshi:*va voir sally*

    Sally: Ah,petit dino,c'est toi ^^

    Yoshi:AGUGUGUGUGUGUGUGUGUGUGUG,HUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU

    *tourne autour de sally et fait des bêtises*

    Sally:....... Tu te sens bien?

    Yoshi:YéPAPAPAPAPAPAPAPAPAPALA!!!!

    Sally:...... O_o *regarde Yoshi*

    425
    Jeudi 14 Juillet 2016 à 12:19
    Daisy.exe*se retien de rire*
    426
    Jeudi 14 Juillet 2016 à 12:22

    Yoshi: Yoshi daaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccceeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee!

    Sally:Whut!!!? ù_ù

    427
    Jeudi 14 Juillet 2016 à 13:45
    Daisy.exe*éclate de rire*
    428
    Jeudi 14 Juillet 2016 à 21:05

    Yoshi:Balaçe Mario sur Sally*

    Mario:Hello,it me.....

    Sally:.. OH non! Je la sens mal..

    mario: *se change en i hate you.exe* MARIO!

    Sally: ..... Purée.................. Pas lui.......!

    Mario:tu veux des spaghettis? *se remt en Mario*

    Sally: Whut... O_o *s'éloigne de mario et Yoshi*

    429
    Jeudi 14 Juillet 2016 à 21:08
    Daisy.exe*les regarde*
    430
    Jeudi 14 Juillet 2016 à 21:10

    Yoshi:Ouais,Ouais ouais *tourne sur lui même*

    Mario: *repète sans cesse* Super Princesse Peach *je sais pas pk*

    Sally:HAAAAAAAAAAAAAA! *pète un cable* Amy! Attend moi!!! *s'enfuie*

    431
    Jeudi 14 Juillet 2016 à 21:12
    Daisy.exe*prend sa poêle pour assomer Mario et Yoshi*
    432
    Jeudi 14 Juillet 2016 à 21:27

    Bowser:NON! MA POELE,VOLEUSE DE POELE!!!!!!! *poursuit Daisy.exe*

    Lol ^^

    Shadow: ....... J'ai rien vu...

    433
    Jeudi 14 Juillet 2016 à 21:53
    Daisy.exe*giffle Bowser avec la poêle*
    434
    Jeudi 14 Juillet 2016 à 21:57

    Bowser:*assomé*

    Shadow:........ Tu ne la pas loupé XD

    435
    Jeudi 14 Juillet 2016 à 22:04
    Daisy.exe: je loupe personne
    436
    Jeudi 14 Juillet 2016 à 22:11

    Bowser: Princesse peach! Vous êtes morte?

    Amy: *recherche toujours Sonic* Mais je comprend pas..

    Cream: Yoshi nous a dupée!!!!!

    Cosmo:...... Il l'a peut être fait sa par erreur ^^

    Amy: JE M'EN FICHE,JE RETROUVERAIS MON SONIC! QUE VOUS LE VOULIEZ OU NON!!!!

    Cram et Cosmo: Sa sert à rien de t'énervée,Amy.....

    Amy: Pardon...

    Cosmo: Aller, ce n'est pas grave ;)

    Amy: ^^! OH LA-VAS! *aperçoie Sonic.exe* SOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOONIC!

    Cream et Cosmo:*tombent* Mais elle est srx avec Sonic parci et Sonic par là..........

    437
    Jeudi 14 Juillet 2016 à 22:16
    Sonic.exe*l'indifférence*
    438
    Jeudi 14 Juillet 2016 à 22:21

    Mario:Super,elles nous ont vu.......... *regardent les filels*

    Amy: SONIC KUN! *prend Sonic.exe dans ses bras,croyant que c'est Sonic the hedgehog XD*

    Cream:..... *Regarde Amy* O_o

    Cosmo:Bonjours les g......... *me regarde avec un air choquée*

    439
    Jeudi 14 Juillet 2016 à 22:26
    Sonic.exe: lâche-moi boule de poil
    440
    Jeudi 14 Juillet 2016 à 22:33

    Cosmo: Tails..... *me regarde*

    ......... ù_ù Quoi?????

    Cosmo:C'est vraiment toi??.....

    Dr.Mario:Y'a qu'un seul Tails ici,et c'et lui!

    TOI! TAIT TOI! *donne un coup de queue à Dr.Mario*

    Cosmo:Mais que t'es t-il arrivé? t'es tout bizzar....

    C'est lui! *pointe dr.Mario du doigt*

    Cosmo:Encore ce psychopathe!!!!!!!!!! -.-'

    Il a joué les chirugiens....

    Shadow: ......

    Et toi,tu la tue,tu te prend un coup en pleine face! *regarde Shadow*

    Shadow:....... d'-a-accord,tails,relaxe.......... *comme à être appeuré*

    Cosmo: Bah tiens,il devient froussard?

    Yoshi:Shadow the Froussard,Shadow the froussard ^^ *se moque de lui*

    Shadow:N.; Non!

    Cream:Amy! Laisse Mr Sonic tranquille.......

    Yoshi:Hé c'est plus Tails mais Tails Doll.........

    Cosmo: Ok........

    441
    Jeudi 14 Juillet 2016 à 22:48
    Sonic.exe*les regarde*
    442
    Jeudi 14 Juillet 2016 à 23:04

    Mario:Humhumhumhumhumhum *fait son hymne*

    Cosmo: Amy!Tu viens?

    Amy:Non! Je reste avec mon sonic!

    Ce'st aps ton soit disant "sonic", je te conseille de levée les yeux,idiote!

    Cream:Tails doll dit vrai Amy......

    Amy: Mais y'a rien à craindre..

    443
    Jeudi 14 Juillet 2016 à 23:25
    Sonic.exe: tu devrais me craidre cocote*sourire malsain*
    444
    Vendredi 15 Juillet 2016 à 21:53

    Amy:*lève les yeux* AHHHHHHHHHHHHHHHHHHHHHHHHH *cri et court*

    *se moque d'Amy* MDR, Oh Pauvre fillete XD

    Cosmo:Tails!

    Quoi! Hé,je fais ce que je veux...

    (Quelqu'un a copiée ton pseudo: elle s'appelle: <<DAISYEXE.>> tu la connais?)

    445
    Vendredi 15 Juillet 2016 à 22:57
    (Un connard. Ignore-le) Sonic.exe*rigole*
    446
    Vendredi 15 Juillet 2016 à 23:01

    (Okay ^^, il vient faire chier son monde comme Dian Il se prend pour Snake et ses points d'exclamation...!)

    Luigi.exe:Jolie sourire Sonic.exe ^^

    Cream:Pour vous ouais,mais nous,nope...

    Luigi.exe:Vous avez même pas le sens de la rigolade,vous...!

     

    447
    Vendredi 15 Juillet 2016 à 23:09

    (Qu'il va regardé des vidéo de SMG4,y'en a quelques une qui sont trop bizarr..)

    448
    Vendredi 15 Juillet 2016 à 23:10
    (C'est encore autre chose)Sonic.exe: chochotes
    449
    Vendredi 15 Juillet 2016 à 23:14

    Amy:........... idiot,t'aurais pas pu me prévenir que t'avais changé!!!

    Euh.. Amy... c'est toi la fautive!

    Amy:Je peux savoir pourquoi,hein?

    Bah,je t'avais prévenue de le laissé,mais tu ne m'a pas écoutée.....

    Amy:Pfff,Et toi alors,tu écouté Sonic Hein? Tu ce que tu faisait c'était gâché ses plans car tu n'est qu'un bavard!!!!!

     

    450
    Vendredi 15 Juillet 2016 à 23:15

    (je vais dormir.. à demain ;)

    451
    Vendredi 15 Juillet 2016 à 23:23
    Sonic.exe: boucle la
    452
    Samedi 16 Juillet 2016 à 21:01

    Amy:Moi ou lui! *me pointe du doigt*

    Tu sais que sa se fait pas de pointer les gens du doigt? -_-'

    Amy: Euh.. Si sa se fait...

    453
    Samedi 16 Juillet 2016 à 21:05
    Daisy.exe: c'est mal poli boule de poil
    454
    Samedi 16 Juillet 2016 à 21:30

    Amy:Pff,t'es qu'un chouchou!

    attedn,répète! Nan,je crois pas être sa... loin de la.. par rapport à toi,moi j'ai une cervelle!!!! Donc va voir ton marteau pico et va jouée avec....!

    455
    Samedi 16 Juillet 2016 à 23:15
    Sonic.exe*vous regarde*
    456
    Dimanche 17 Juillet 2016 à 11:02

    Amy:.... Tu crois vraiment que j'ai peur de toi,idiot?

    Non bah, moi non plus.....

    Amy: Donc tu me laisse!

    ........ *ignore Amy et regarde le paysage sans répondre*

    457
    Dimanche 17 Juillet 2016 à 11:07
    Sonic.exe: dégage Amy
    458
    Dimanche 17 Juillet 2016 à 11:17

    Amy: Laisse moi!Sonic.......... 

    Quel idiote cette fille....

    Amy:............ ET TOI,TAILS!!!!

    AH tu me cherche! *la fixe avec un grand sourire flipant*

    459
    Dimanche 17 Juillet 2016 à 11:42
    Daisy.exe*te regarde*
    460
    Dimanche 17 Juillet 2016 à 11:45

    Amy:*pas trop rassurée* euh.. Nope....

    Bon alors tu me cherche pas... Je t'épargne seulement cette fois!

    Amy:  M-Merci.........

    Cream:Bon problème régler,hein?

    Amy:*me fixe avec un regard *

    *la fixe aussi*

    461
    Dimanche 17 Juillet 2016 à 13:21
    Daisy.exe*regarde Cream*
    462
    Dimanche 17 Juillet 2016 à 20:51

    Cream:........

    Amy:............

    ..........

    (aucune réponse XD)

    463
    Dimanche 17 Juillet 2016 à 22:14
    Daisy.exe: bon
    464
    Dimanche 17 Juillet 2016 à 22:16

    Yoshi: Aucune réac....

    Knukcles: Ouais *auche ses épaules*

    465
    Dimanche 17 Juillet 2016 à 22:33
    Daisy.exe*prend sa poêle*
    466
    Dimanche 17 Juillet 2016 à 22:34

    Knukcles:*regarde la pôele*..................

    467
    Dimanche 17 Juillet 2016 à 22:47
    Daisy.exe: je frappe qui en premier?
    468
    Lundi 18 Juillet 2016 à 10:22

    Cream:Hum... Personne......

    Amy: TAILS!

    Et pourquoi moi,hein.... *part s'allonger sur l'herbe*

    Cosmo: *viens me voir* Pourquoi tu veux pas redevenir le Tails qu'on a tous connu?

    Parce que... et pis,j'ai fais mon choix! Je suis mieux comme sa qu'avant. ^_^ 

    Knukcles:C'est l'inverse!

    de?

    Knukcles:T'était mieux avant que là!

    Que tu le veuille ou non,je resterais comme sa... *dort*

    Knukcles:Quel idiot,ce gars là!

    *ouvre un oeil* Fière de l'être ^^ *se rendort*

    Cream:Okay.. bon alors c'est Amy qui se prend la poêle!

    Cosmo:*rigole*

    Amy:QUOI! AH NON!

    469
    Lundi 18 Juillet 2016 à 10:33
    Daisy.exe*s'approche d'Amy*
    470
    Lundi 18 Juillet 2016 à 13:33

    Amy:*prend la fuite*

    La fuite c'est tout droit et tu tourne à gauche MDR. 

    Amy:Ok... *écoute ce que je lui dit et se cogne sur un arbre* Aie.....

    Ah mince ne faite c'était à droite.......

    Amy:T-T-TAILS! ARGH SI TU CONTINUE COMME SA,JE TE TIRE TES DEUX QUEUES! PIGE?!

    T'es sérieuse,miss....

    Amy:et m'appelle pas miss!!!!

    471
    Lundi 18 Juillet 2016 à 13:53
    Daisy.exe: pigeon x)
    472
    Lundi 18 Juillet 2016 à 13:57

    Amy:qui,lui?

    ............

    473
    Lundi 18 Juillet 2016 à 14:04
    Daisy.exe: nan, l'arbre que tu viens de te bouffer xD
    474
    Lundi 18 Juillet 2016 à 14:14

    Amy: Ah bah désolée,mais y'a un renard jaune à côté de moi qui m'as fais prendre l'arbre..

    Mais je suis désolé... Amy....

    475
    Lundi 18 Juillet 2016 à 14:35
    Daisy.exe: en même temps, tu comprends pas le 2nd degré
    476
    Lundi 18 Juillet 2016 à 14:38

    Amy: Hé bah.. pour quelqu'un qui disait qu'il avait de la cervelle... ZERO!

    .................... Oui bon,j'ai peut être étais trop loin.... ^^'

    477
    Lundi 18 Juillet 2016 à 15:05
    Daisy.exe*te regarde*
    478
    Lundi 18 Juillet 2016 à 20:13

    Bon sinon.. tu jarre quand?

    Amy:T'es pressé de de me voir partir....

    Bah oui,tu m'embête...

    Amy:NOPE! c'est toi!

    479
    Samedi 23 Juillet 2016 à 12:53

    Daisy.exe: dégage Amy -_-

    480
    Samedi 23 Juillet 2016 à 13:04

    Amy:NON!

    Mario:*chante du.. Japonais?*

    Tu te sent bien,Mario??? D8

    481
    Samedi 23 Juillet 2016 à 13:49

    Daisy.exe*prend son couteau*

    482
    Samedi 23 Juillet 2016 à 13:53

    Mario:........ PIKA!

    Bon..il a péter un plomb!

    Yoshi:...... MARIO! STOP!

    483
    Samedi 23 Juillet 2016 à 13:54

    Daisy.exe*s'approche de Mario*

    484
    Samedi 23 Juillet 2016 à 13:55

    Mario:PIKACHUUUUUUUUUUUUUUUUUUUUUUUUUUUU!

    Yoshi et Knukcles:Whut...o_O''

    Suivre le flux RSS des commentaires


    Ajouter un commentaire

    Nom / Pseudo :

    E-mail (facultatif) :

    Site Web (facultatif) :

    Commentaire :